bug20151006-rc.should-vdj.fa 1.24 KB
Newer Older
1 2

# 0000-nck-TRB.should-vdj.fa.rc
3
>TRBV7-2*02 3/T/0 TRBJ2-3*01  [TRB] BUG
4 5 6 7 8 9 10 11 12 13 14 15 16
CCCGCTTACCGAGCACTGTCAGCCGGGTGCCTGGGCCAAAATACTGCGTATCTGTGCTAAAGCTGCTGGCACAGAGATACACGGCCGAGTCCTCCTGCTGTGTGCGCTGGATCGTCAGAGTGGAGACGGATTCCCCAGTCCTCTCTGCAGAGAAGCGATCACTGGGCAGCCCTGATTTGTCTGGTGCACTGTTGCCTTGGAAGTAAATTAAAAACTCCAGGCCCTGCCCCAGCCTCTGCCGGTACCAGTAAAGGGTAA

# 0119-lil-IGK+-TRA+D-TRD+-TRG.should-vdj.fa.rc
>Intron 2/0/9 KDE  [IGK+]
CCTCAGAGGTCAGAGCAGGTTGTCCTAGGGAGCAGGGAGGCTTCCTAGGGAGGTCAGACTCCAAATAGTGGATATGGCAAAAATGCAGCTGCAGACTCATGAGGAGTCGCCCTGGGCTGCCACTCAGGAAAGCTGGCTACGGCAGCATCAATCGGGCAGACACAGGGTGGCCACGGCCACTAGCGGCAAGGCGGCTGCCCCAAGAGCGCGGTGGCATGGCCACCAAAGCCACTCAATCGAGAAAGACCGCGGCTCTGTCTACAGCTCGCGGTGCCACG

# 0122-lil-TRG.should-vdj.fa.rc
>TRGV5*01 4/2/5 TRGJP2*01  [TRG]
TTACCAGGCGAAGTTACTATGAGCCTAGTCCCTTTTGCAAACGTCTTGATCCAATCACTCTTCCCAGGTGGCACAGTAATAGACCCCAGAATCATTTTCAATTAGATTTCGTAGTATCAATATCCAGCTCCACCTCCTGGGTGTATGAGTATAATACTTTCCTGGACTGAGTCCTGATTCCAACACATCCTTTGAGTTGGAGACGTCATAGTACAGAAGACGCTGTGGGGCCTTCC

# 0169-lil-TRA+D.should-vdj.fa.rc
>TRDD2*01 13//8 TRAJ29*01  [TRA+D]
GGCAAAAGCATTCTAGGTACACTGAAAAATAATTCAAGGGAAGAAGCCATTGCTGATCAAAATCAAGGATGGCTAGAAACACTTACTTGCAATCACAGAAAGTCTTGTGCCCTTTCCAAAGACAAGAGGTGTCCCTTCCATGAAACACATCAGTATAAAAACCCTCTTCTTCCTTTTTCCCTTTCCTTGGCACTTTGCCATCACCACCCGCT