4619-nck-IGH.should-vdj.fa 594 Bytes
Newer Older
1
#  sequence:    GTGTGAACTCCTGGAGTGGTGGTAGCGGGAACTGGTTC
2
#               |||||||
3 4
# IGHV3-64D*06  GTGTGAAAGA                   |||||||||
# IGHJ5*02                                 ACAACTGGTTC
5 6
#                          || ||||||||||||
# IGHD2-15*01       AGGATATTGTAGTGGTGGTAGCTGCTACTCC
7
>IGHV3-64D*06 (3/CTCC/7, 3/CTCCTGG/10) IGHD2-15*01 9/GGG/2 IGHJ5*02 [IGH]
8 9 10
CCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAATGGGGGTAGCACATACTACGCAGACTCCGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAGCAGTCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGTGA
ACTCCTGGAGTGGTGGTAGCGG
GAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCAC