window-change.should_get 540 Bytes
Newer Older
1
!LAUNCH: (cd .. ; python analysis-windows.py -w 40 ../data/analysis-with-windows.analysis ; python analysis-windows.py -w 60 ../data/analysis-with-windows.analysis.new ; ./diff_json.sh ../data/analysis-with-windows.analysis{,.new.new} -s ; cat ../data/analysis-with-windows.analysis.new)
2 3 4 5 6 7 8 9

$ First and last files are identical
1:are identical

$ Middle file has the good 40-bp windows
1: "id": "CTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGAC"
1: "id": "CTGTACCGGGGAGGAACAATATAGCAGCTGGTACTTTGAC"
1: "id": "GTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTA"