algo.org 32.4 KB
Newer Older
1
#+TITLE: Vidjil Algorithm -- Command-line Manual
2
#+AUTHOR: The Vidjil team (Mathieu, Mikaël, Marc, Tatiana and Rayan)
3 4 5 6 7
#+HTML_HEAD: <link rel="stylesheet" type="text/css" href="../css/org-mode.css" />

# This manual can be browsed online:
#     http://www.vidjil.org/doc/algo.html               (last stable release)
#     http://git.vidjil.org/blob/master/doc/algo.org    (development version)
8

9
# Vidjil -- High-throughput Analysis of V(D)J Immune Repertoire -- [[http://www.vidjil.org]]
10
# Copyright (C) 2011, 2012, 2013, 2014, 2015, 2016 by Bonsai bioinformatics
11
# at CRIStAL (UMR CNRS 9189, Université Lille) and Inria Lille
Marc Duez's avatar
Marc Duez committed
12
# contact@vidjil.org
Mikaël Salson's avatar
Mikaël Salson committed
13

Mikaël Salson's avatar
Mikaël Salson committed
14 15 16 17
V(D)J recombinations in lymphocytes are essential for immunological
diversity. They are also useful markers of pathologies, and in
leukemia, are used to quantify the minimal residual disease during
patient follow-up.
Mikaël Salson's avatar
Mikaël Salson committed
18

19
The Vidjil algorithm processes high-throughput sequencing data to extract V(D)J
Mathieu Giraud's avatar
Mathieu Giraud committed
20
junctions and gather them into clones. Vidjil starts 
Mikaël Salson's avatar
Mikaël Salson committed
21 22
from a set of reads and detects "windows" overlapping the actual CDR3.
This is based on an fast and reliable seed-based heuristic and allows
23
to output all sequenced clones. The analysis is extremely fast
Mathieu Giraud's avatar
Mathieu Giraud committed
24
because, in the first phase, no alignment is performed with database
25 26 27
germline sequences. At the end, only the representative sequences 
of each clone have to be analyzed. Vidjil can also cluster similar
clones, or leave this to the user after a manual review in the browser.
Mikaël Salson's avatar
Mikaël Salson committed
28

29
The method is described in the following reference:
Mikaël Salson's avatar
Mikaël Salson committed
30

Mikaël Salson's avatar
Mikaël Salson committed
31 32
Mathieu Giraud, Mikaël Salson, et al.,
"Fast multiclonal clusterization of V(D)J recombinations from high-throughput sequencing",
33 34
BMC Genomics 2014, 15:409
http://dx.doi.org/10.1186/1471-2164-15-409
Mikaël Salson's avatar
Mikaël Salson committed
35 36 37

Vidjil is open-source, released under GNU GPLv3 license.

38 39 40
* Requirements and installation

** Supported platforms
Mikaël Salson's avatar
Mikaël Salson committed
41

42
The Vidjil algorithm has been successfully tested on the following platforms :
Mikaël Salson's avatar
Mikaël Salson committed
43 44
 - CentOS 6.3 amd64
 - CentOS 6.3 i386
45 46
 - Debian Squeeze 6.0
 - Debian Wheezy 7.0 amd64
47
 - Fedora 19
48
 - FreeBSD 9.2
49 50
 - Ubuntu 12.04 LTS amd64
 - Ubuntu 14.04 LTS amd64
Mikaël Salson's avatar
Mikaël Salson committed
51

Mathieu Giraud's avatar
Mathieu Giraud committed
52 53 54
Vidjil is developed with continuous integration using systematic unit and functional testing.
The development team internally uses [[https://jenkins-ci.org/][Jenkins]] for that.
Moreover, the results of some of these tests can be publicly checked on [[https://travis-ci.org/vidjil/vidjil][travis-ci.org]].
Mikaël Salson's avatar
Mikaël Salson committed
55

56 57 58 59 60 61
** Build requirements (optional)

This paragraph details the requirements to build Vidjil from source.
You can also download a static binary (see next paragraph, 'Installation').

To compile Vidjil, make sure:
62
  - to be on a POSIX system ;
63
  - to have a C++11 compiler (as =g++= 4.8 or above or =clang= 3.3 or above)
64 65 66
  - to have the =zlib= installed (=zlib1g-dev= package under Debian/Ubuntu,
    =zlib-devel= package under Fedora/CentOS).

67 68 69 70 71 72 73

*** CentOS 6

g++-4.8 is included in the devtools 2.0.

#+BEGIN_SRC sh
sudo wget http://people.centos.org/tru/devtools-2/devtools-2.repo -O /etc/yum.repos.d/devtools-2.repo
74 75 76 77 78
sudo yum install devtoolset-2-gcc devtoolset-2-binutils devtoolset-2-gcc-c++ devtoolset-2-valgrind

# scl enable devtoolset-2 bash     # either open a shell running devtools
source /opt/rh/devtoolset-2/enable # ... or source devtools in the same shell
#+END_SRC
79 80 81 82 83

*** FreeBSD 9.2

g++-4.8 is included in FreeBSD 9.2.

84 85 86 87
You may also need to install the =gzstream= library with:
#+BEGIN_SRC sh
pkg install gzstream
#+END_SRC
88

89 90 91
Also Vidjil uses GNU make which requires =gmake= under FreeBSD.
At the time of redacting the documentation, =g++= requires extra options to
ensure flawless compilation and execution of Vidjil:
92
#+BEGIN_SRC sh
93 94 95 96
make MAKE=gmake CXXFLAGS="-D_GLIBCXX_USE_C99 -Wl,-rpath=/usr/local/lib/gcc49"
#+END_SRC
The =gcc49= at the end of the command line is to be replaced by the =gcc= version
used. 
97
*** Debian Squeeze 6.0 / Wheezy 7.0
98 99 100 101 102 103

g++-4.8 should be pinned from testing.
Put in =/etc/apt/preferences= the following lines:

#+BEGIN_SRC sh
Package: *
104
Pin: release n=wheezy # (or squeeze)
105 106 107 108 109 110 111 112 113 114 115
Pin-Priority: 900

Package: g++-4.8, gcc-4.8, valgrind*
Pin: release n=jessie
Pin-Priority: 950
#+END_SRC

Then g++ 4.8 can be installed.

#+BEGIN_SRC sh
apt-get update
116
apt-get install -t jessie g++-4.8 valgrind
117 118 119
#+END_SRC


120 121 122 123
*** Ubuntu 14.04 LTS

#+BEGIN_SRC sh
sudo apt-get install g++-4.8
Mathieu Giraud's avatar
Mathieu Giraud committed
124
#+END_SRC
125 126 127 128 129 130 131 132 133 134

*** Ubuntu 12.04 LTS

g++-4.8 is included in the devtools 2.0.

#+BEGIN_SRC sh
sudo apt-get install python-software-properties
sudo add-apt-repository ppa:ubuntu-toolchain-r/test
sudo apt-get update
sudo apt-get install g++-4.8
Mathieu Giraud's avatar
Mathieu Giraud committed
135
#+END_SRC
136 137 138 139




140
** Installation
Mikaël Salson's avatar
Mikaël Salson committed
141

142
#+BEGIN_SRC sh
Mikaël Salson's avatar
Mikaël Salson committed
143 144

make germline
Mathieu Giraud's avatar
Mathieu Giraud committed
145
   # get IMGT germline databases (IMGT/GENE-DB) -- you have to agree to IMGT license: 
Mikaël Salson's avatar
Mikaël Salson committed
146 147 148 149 150 151
   # academic research only, provided that it is referred to IMGT®,
   # and cited as "IMGT®, the international ImMunoGeneTics information system® 
   # http://www.imgt.org (founder and director: Marie-Paule Lefranc, Montpellier, France). 
   # Lefranc, M.-P., IMGT®, the international ImMunoGeneTics database,
   # Nucl. Acids Res., 29, 207-209 (2001). PMID: 11125093

152 153 154 155 156

# either
make                     # build Vijil from the sources (see the requirements, above)

# or
157
wget http://bioinfo.lifl.fr/vidjil/vidjil-2015.12_x86_64 -O vidjil
158 159
                         # download a static binary (built for x86_64 architectures)

Mikaël Salson's avatar
Mikaël Salson committed
160
./vidjil -h              # display help/usage
161
#+END_SRC
Mikaël Salson's avatar
Mikaël Salson committed
162

163
If your build system does not use C++11 by default, you should replace the =make= commands by:
164

165 166
#+BEGIN_SRC sh
make CXXFLAGS='-std=c++11'                           ### gcc-4.8
167
make CXXFLAGS='-std=c++11' LDFLAGS='-stdlib=libc++'  ### OS X Mavericks
168
#+END_SRC
169

170 171 172 173 174 175
** Self-tests (optional)

You can run the tests with the following commands:

#+BEGIN_SRC sh
make data
Mathieu Giraud's avatar
Mathieu Giraud committed
176
   # get IGH recombinations from a single individual, as described in:
177 178 179 180
   # Boyd, S. D., and al. Individual variation in the germline Ig gene
   # repertoire inferred from variable region gene rearrangements. J
   # Immunol, 184(12), 6986–92.

181
make test                # run self-tests (can take 5 to 60 minutes)
182 183
#+END_SRC

Mikaël Salson's avatar
Mikaël Salson committed
184

185
* Input and parameters
186 187

The main input file of Vidjil is a /set of reads/, given as a =.fasta=
188 189
or =.fastq= file, possibly compressed with gzip (=.gz=).
This set of reads can reach several gigabytes. It is
190 191 192
never loaded entirely in the memory, but reads are processed one by
one by the Vidjil algorithm.

193 194
The =-h= and =-H= help options provide the list of parameters that can be
used. We detail here the options of the main =-c clones= command.
195 196 197 198 199 200

The default options are very conservative (large window, no further
automatic clusterization, see below), leaving the user or other
software making detailed analysis and decisions on the final
clustering.

201 202 203
** Germline selection

#+BEGIN_EXAMPLE
204
Germline databases (at least one -V/(-D)/-J, or -G, or -g option must be given for all commands except -c germlines)
205
  -V <file>     V germline multi-fasta file
206
  -D <file>     D germline multi-fasta file (and resets -m and -w options), will segment into V(D)J components
207 208
  -J <file>     J germline multi-fasta file
  -G <prefix>   prefix for V (D) and J repertoires (shortcut for -V <prefix>V.fa -D <prefix>D.fa -J <prefix>J.fa) (basename gives germline code)
209 210 211
  -g <path>     multiple locus/germlines. In the path <path>, takes 'germlines.data' to select locus and parameters
                Selecting '-g germline' processes TRA, TRB, TRG, TRD, IGH, IGK and IGL locus, possibly with some incomplete/unusal recombinations
                A different 'germlines.data' file can also be provided with -g <file>
212 213 214 215

Locus/recombinations
  -i            try to detect incomplete/unusual recombinations (locus with '+', must be used with -g)
  -2            try to detect unexpected recombinations (must be used with -g)
216 217 218 219
#+END_EXAMPLE

 - Options such as =-G germline/IGH= or =-G germline/TRG= select one germline system.
 - The =-V/(-D)/-J= options enable to select individual V, (D) and J repertoires (fasta files).
Mathieu Giraud's avatar
Mathieu Giraud committed
220
   This allows in particular to select incomplete rearrangement using custom V or J repertoires with added sequences.
221
 - The =-g germline/= option launches the analysis on the seven germlines, selecting the best locus for each read.
222 223
   Using =-g germline/ -i= tests also some incomplete and unusual recombinations (locus with a =+= in their name),
   and using =-g germline/ -i -2= further test unexpected recombinations.
224
   See [[http://git.vidjil.org/blob/master/doc/locus.org][locus.org]] for information on the analyzable locus.
225
 - Analyzed locus and parameters are configured through the =germline/germlines.data= file.
226 227
   A =germline/isotypes.data= file is provided to look for sequences with, on one side, IGHJ (or even IGHV) genes,
   and, on the other side, an IGH constant chain.
228
   To select a custom set of TR or Ig locus, you may copy =germline/germlines.data= into a new file,
229
   as for example =germline/custom-germlines.data=, and run Vidjil with =-g germline/custom-germlines.data -i -2=.
230
 - Several =-g= options can be used, as for instance =-g germline -g germline/isotypes.data=.
231

Mathieu Giraud's avatar
Mathieu Giraud committed
232 233 234 235 236 237 238 239 240
** Main algorithm parameters

#+BEGIN_EXAMPLE
Window prediction
  (use either -s or -k option, but not both)
  -s <string>   spaced seed used for the V/J affectation
                (default: #####-#####, ######-######, #######-#######, depends on germline)
  -k <int>      k-mer size used for the V/J affectation (default: 10, 12, 13, depends on germline)
                (using -k option is equivalent to set with -s a contiguous seed with only '#' characters)
241
  -w <int>      w-mer size used for the length of the extracted window (default: 50)
242
  -e <float>    maximal e-value for determining if a segmentation can be trusted (default: 'all', no limit)
243
  -t <int>      trim V and J genes (resp. 5' and 3' regions) to keep at most <int> nt (default: 100) (0: no trim)
Mathieu Giraud's avatar
Mathieu Giraud committed
244 245
#+END_EXAMPLE

246
The =-s=, =-k= are the options of the seed-based heuristic. A detailed
247 248
explanation can be found in (Giraud, Salson and al., 2014).
/These options are for advanced usage, the defaults values should work./
249
The =-s= or =-k= option selects the seed used for the k-mer V/J affectation.
Mathieu Giraud's avatar
Mathieu Giraud committed
250 251

The =-w= option fixes the size of the "window" that is the main
252
identifier to gather clones. The default value (=-w 50=) was selected
253 254 255 256
to ensure a high-quality clone gathering: reads are clustered when
they /exactly/ share, at the nucleotide level, a 50 bp-window centered
on the CDR3. No sequencing errors are corrected inside this window.
The center of the "window", predicted by the high-throughput heuristic, may
Mikaël Salson's avatar
Mikaël Salson committed
257
be shifted by a few bases from the actual "center" of the CDR3 (for TRG,
Mathieu Giraud's avatar
Mathieu Giraud committed
258 259 260
less than 15 bases compared to the IMGT/V-QUEST or IgBlast prediction
in >99% of cases). The extracted window should be large enough to
fully contain the CDR3 as well as some part of the end of the V and
261
the start of the J, or at least some specific N region, to uniquely identify a clone.
Mathieu Giraud's avatar
Mathieu Giraud committed
262

263 264 265 266 267 268 269 270
Setting =-w= to higher values (such as =-w 60= or =-w 100=) makes the clone gathering
even more conservative, enabling to split clones with low specificity (such as IGH with very
large D, short or no N regions and almost no somatic hypermutations). However, such settings
may "segment" (analyze) less reads, depending on the read length of your data, and may also
return more clones, as any sequencing error in the window is not corrected.

Setting =-w= to lower values than 50 may "segment" (analyze) a few more reads, depending
on the read length of your data, but may in some cases falsely cluster reads from
271 272
different clones.
For VJ recombinations, the =-w 40= option is usually safe, and =-w 30= can also be tested.
273
Setting =-w= to lower values is not recommended.
Mathieu Giraud's avatar
Mathieu Giraud committed
274

275
The =-e= option sets the maximal e-value accepted for segmenting a sequence.
276
It is an upper bound on the number of exepcted windows found by chance by the seed-based heuristic.
277 278
The e-value computation takes into account both the number of reads in the
input sequence and the number of locus searched for.
279 280 281
The default value is 1.0, but values such as 1000, 1e-3 or even less can be used
to have a more or less permissive segmentation.
The threshold can be disabled with =-e all=.
282

Mikaël Salson's avatar
Mikaël Salson committed
283
The =-t= option sets the maximal number of nucleotides that will be indexed in
284 285
V genes (the 3' end) or in J genes (the 5' end). This reduces the load of the
indexes, giving more precise window estimation and e-value computation.
286
The default is =-t 100=.
287

288
** Thresholds on clone output
289 290 291 292

The following options control how many clones are output and analyzed.

#+BEGIN_EXAMPLE
293
Limits to report a clone (or a window)
294
  -r <nb>       minimal number of reads supporting a clone (default: 5)
295 296
  -% <ratio>    minimal percentage of reads supporting a clone (default: 0)

297
Limits to further analyze some clones
298
  -y <nb>       maximal number of clones computed with a representative ('all': no limit) (default: 100)
299
  -z <nb>       maximal number of clones to be analyzed with a full V(D)J designation ('all': no limit, do not use) (default: 100)
300
  -A            reports and segments all clones (-r 1 -% 0 -y all -z all), to be used only on very small datasets
301 302
#+END_EXAMPLE

303
The =-r/-%= options are strong thresholds: if a clone does not have
304 305
the requested number of reads, the clone is discarded (except when
using =-l=, see below).
306
The default =-r 5= option is meant to only output clones that
307
have a significant read support. *You should use* =-r 1= *if you
308
want to detect all clones starting from the first read* (especially for
309 310
MRD detection).

311 312
The =-y= option limits the number of clones for which a representative
sequence is computed. Usually you do not need to have more
313
representatives (see below), but you can safely put =-y all= if you want
314 315
to compute all representative sequences.

316
The =-z= option limits the number of clones that are fully analyzed,
317 318
/with their V(D)J designation and possibly a CDR3 detection/,
in particular to enable the web application
319
to display the clones on the grid (otherwise they are displayed on the
320
'?/?' axis).
321 322 323
If you want to analyze more clones, you should use =-z 200= or
=-z 500=.  It is not recommended to use larger values: outputting more
than 500 clones is often not useful since they can not be visualized easily
324
in the web application, and takes large computation time (full dynamic programming,
325
see below).
326

327
Note that even if a clone is not in the top 100 (or 200, or 500) but
328
still passes the =-r=, =-%= options, it is still reported in both the =.vidjil=
329
and =.vdj.fa= files. If the clone is at some MRD point in the top 100 (or 200, or 500),
Mikaël Salson's avatar
Mikaël Salson committed
330
it will be fully analyzed/segmented by this other point (and then
331
collected by the =fuse.py= script, using representatives computed at this
332
other point, and then, on the web application, correctly displayed on the grid).
333
*Thus is advised to leave the default* =-z 100= *option
334
for the majority of uses.*
335 336 337 338 339

The =-A= option disables all these thresholds. This option should be
used only for test and debug purposes, on very small datasets, and
produce large file and takes huge computation times.

Mikaël Salson's avatar
Mikaël Salson committed
340

341 342 343
** Labeled windows

Vidjil allows to indicate that specific windows that must be followed
344
(even if those windows are 'rare', below the =-r/-%= thresholds).
345 346 347

Such windows can be provided either with =-W <window>=, or with =-l <file>=.
The file given by =-l= should have one window by line, as in the following example:
Mikaël Salson's avatar
Mikaël Salson committed
348

349
#+BEGIN_EXAMPLE
350 351
GAGAGATGGACGGGATACGTAAAACGACATATGGTTCGGGGTTTGGTGCT my-clone-1
GAGAGATGGACGGAATACGTTAAACGACATATGGTTCGGGGTATGGTGCT my-clone-2 foo
352 353 354
#+END_EXAMPLE

Windows and labels must be separed by one space.
Mikaël Salson's avatar
Mikaël Salson committed
355 356 357
The first column of the file is the window to be followed
while the remaining columns consist of the window's label.
In Vidjil output, the labels are output alongside their windows.
Mikaël Salson's avatar
Mikaël Salson committed
358

359 360 361 362
With the =-F= option, /only/ the labeld windows are kept. This allows
to quickly filter a set of reads, looking for a known window,
with the =-FaW <window>= options:
All the reads with this windows will be extracted to =out/seq/clone.fa-1=.
363

364 365 366 367 368 369
** Clone analysis: VDJ assignation and CDR3 detection

The =-3= option launches a CDR3/JUNCTION detection based on the position
of Cys104 and Phe118/Trp118 amino acids. This detection relies on alignment
with gapped V and J sequences, as for instance, for V genes, IMGT/GENE-DB sequences.

370 371 372
The advanced =-f= option sets the parameters used in the comparisons between
the clone sequence and the V(D)J germline genes. The default values should work.

373
   The advanced =-m= option controls the minimum difference of positions between the end
374
   of the V and the start of the J. Note that it is even possible to set =-m -10=
375 376
   (meaning that V and J could overlap 10 bp). This is the default for VJ recombinations
   (except when using a =germlines.data= file).
377

378
** Further clustering (experimental)
379

380 381
The following options are experimental and have no consequences on the =.vdj.fa= file,
nor on the standard output. They instead add a =clusters= sections in the =.vidjil= file
382
that will be visualized in the web application.
383

384 385 386 387 388
The =-n= option triggers an automatic clustering using DBSCAN algorithm (Ester and al., 1996).
Using =-n 5= usually cluster reads within a distance of 1 mismatch (default score
being +1 for a match and -4 for a mismatch). However, more distant reads can also
be clustered when there are more than 10 reads within the distance threshold.
This behaviour can be controlled with the =-N= option.
Mikaël Salson's avatar
Mikaël Salson committed
389

390
The =-E= option allows to specify a file for manually clustering two windows
Mikaël Salson's avatar
Mikaël Salson committed
391
considered as similar. Such a file may be automatically produced by vidjil
392
(=out/edges=), depending on the option provided. Only the two first columns
Mikaël Salson's avatar
Mikaël Salson committed
393
(separed by one space) are important to vidjil, they only consist of the 
Mikaël Salson's avatar
Mikaël Salson committed
394
two windows that must be clustered.
Mikaël Salson's avatar
Mikaël Salson committed
395 396


397

398 399
* Output

400
** Main output files
401 402 403

The main output of Vidjil (with the default =-c clones= command) are two following files:

404
 - The =.vidjil= file is /the file for the Vidjil web application/.
405 406
   The file is in a =.json= format (detailed in [[file:format-analysis.org][format-analysis.org]])
   describing the windows and their count, the representatives (=-y=),
407
   the detailed V(D)J and CDR3 designation (=-z=, see warning below), and possibly
408 409
   the results of the further clustering.

410
   The web application takes this =.vidjil= file (possibly merged with
411 412 413
   =fuse.py=) for the /visualization and analysis/ of clones and their
   tracking along different samples (for example time points in a MRD
   setup or in a immunological study).
414
   Please see [[file:browser.org][browser]].org for more information on the web application.
415 416 417 418 419

 - The =.vdj.fa= file is /a FASTA file for further processing by other bioinformatics tools/.
   The sequences are at least the windows (and their count in the headers) or
   the representatives (=-y=) when they have been computed.
   The headers include the count of each window, and further includes the
420
   detailed V(D)J and CDR3 designation (=-z=, see warning below), given in a '.vdj' format, see below.
421 422 423 424 425 426 427 428 429
   The further clustering is not output in this file.

   The =.vdj.fa= output enables to use Vidjil as a /filtering tool/,
   shrinking a large read set into a manageable number of (pre-)clones
   that will be deeply analyzed and possibly further clustered by
   other software.


By default, the two output files are named =out/basename.vidjil= in =out/basename.vdj.fa=, where:
430
 - =out= is the directory where all the outputs are stored (can be changed with the =-o= option).
431 432
 - =basename= is the basename of the input =.fasta/.fastq= file (can be overriden with the =-b= option)

433 434
** Auxiliary output files

435
The =out/basename.windows.fa= file contains the list of windows, with number of occurrences:
436 437 438

#+BEGIN_EXAMPLE
>8--window--1
439
TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
440
>5--window--2
441
CGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTAC
442 443 444 445 446 447 448
ATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGAC
(...)
#+END_EXAMPLE

Windows of size 50 (modifiable by =-w=) have been extracted.
The first window has 8 occurrences, the second window has 5 occurrences.

449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470
The =out/seq/clone.fa-*= contains the detailed analysis by clone, with
the window, the representative sequence, as well as with the most similar V, (D) and J germline genes:

#+BEGIN_EXAMPLE
>clone-001--IGH--0000008--0.0608%--window
TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
>clone-001--IGH--0000008--0.0608%--lcl|FLN1FA001CPAUQ.1|-[105,232]-#2 - 128 bp (55% of 232.0 bp) + VDJ 	0 54 73 84 85 127	IGHV3-23*05 6/ACCCGGGAGGAACAATAT/9 IGHD6-13*01 0//5 IGHJ4*02  IGH SEG_+ 1.946653e-19 1.352882e-19/5.937712e-20
GCTGTACCTGCAAATGAACAGCCTGCGAGCCGAGGACACGGCCACCTATTACTGT
ACCCGGGAGGAACAATATAGCAGCTGGTAC
TTTGACTTCTGGGGCCAGGGGATCCTGGTCACCGTCTCCTCAG

>IGHV3-23*05
GAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTTATAGCAGTGGTAGTAGCACATACTATGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAA
>IGHD6-13*01
GGGTATAGCAGCAGCTGGTAC
>IGHJ4*02
ACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG
#+END_EXAMPLE

The =-a= debug option further output in each =out/seq/clone.fa-*= files the full list of reads belonging to this clone.
The =-a= option produces large files, and is not recommanded in general cases.

471 472
** Diversity measures

473
Several [[https://en.wikipedia.org/wiki/Diversity_index][diversity indices]] are reported, both on the standard output and in the =.vidjil= file:
474 475 476 477 478

- H  (=index_H_entropy=): Shannon's diversity
- E  (=index_E_equitability=): Shannon's equitability
- Ds (=index_Ds_diversity=): Simpson's diversity

479 480
E ans Ds values are between 0 (no diversity, one clone gathers all analyzed reads)
and 1 (full diversity, each analyzed read belongs to a different clone).
481 482
These values are now computed on the windows, before any further clustering.
PCR and sequencing errors can thus lead to slighlty over-estimate the diversity.
483

484 485 486 487
** Unsegmentation causes

Vidjil output details statistics on the reads that are not segmented (not analyzed).
Basically, *an unsegmented read is a read where Vidjil cannot identify a window at the junction of V and J genes*.
488 489
To properly analyze a read, Vijdil needs that the sequence spans enough V region and J region
(or, more generally, 5' region and 3' regions when looking for incomplete or unusual recombinations).
490 491 492 493 494 495 496 497
The following unsegmentation causes are reported:

|                     |                                                                                                                     |
|---------------------+---------------------------------------------------------------------------------------------------------------------|
| =UNSEG too short=   | Reads are too short, shorter than the seed (by default between 9 and 13 bp).                                        |
|---------------------+---------------------------------------------------------------------------------------------------------------------|
| =UNSEG strand=      | The strand is mixed in the read, with some similarities both with the =+= and the =-= strand.                       |
|---------------------+---------------------------------------------------------------------------------------------------------------------|
498
| =UNSEG too few V/J= | No information has been found on the read: There are not enough similarities neither with a V gene or a J gene.     |
499
|---------------------+---------------------------------------------------------------------------------------------------------------------|
500
| =UNSEG only V/5=    | Relevant similarities have been found with some V, but not enough with any J.                                       |
501
|---------------------+---------------------------------------------------------------------------------------------------------------------|
502
| =UNSEG only J/3=    | Relevant similarities have been found with some J, but not enough with any V.                                       |
503 504 505 506 507 508 509 510 511 512
|---------------------+---------------------------------------------------------------------------------------------------------------------|
| =UNSEG ambiguous=   | Vidjil finds some V and J similarities mixed together which makes the situation ambiguous and hardly solvable.      |
|---------------------+---------------------------------------------------------------------------------------------------------------------|
| =UNSEG too short w= | The junction can be identified but the read is too short so that Vidjil could extract the window (by default 50bp). |
|                     | It often means the junction is very close from one end of the read.                                                 |
|---------------------+---------------------------------------------------------------------------------------------------------------------|


Some datasets may give reads with many low =UNSEG too few= reads:

513
 -  =UNSEG too few V/J= usually happens when reads share almost nothing with the V(D)J region.
514 515
    This is expected when the PCR or capture-based approach included other regions, such as in whole RNA-seq.

516
 - =UNSEG only V/5= and =UNSEG only J/3= happen when reads do not span enough the junction zone.
517 518 519 520 521 522
    Vidjil detects a “window” including the CDR3. By default this window is 50bp long,
    so the read needs be that long centered on the junction.

See [[http://git.vidjil.org/blob/master/doc/browser.org][browser.org]] for information on the biological or sequencing causes that can lead to few segmented reads.


523 524 525 526 527 528 529 530 531 532 533 534 535 536
** Filtering reads

It is possible to extract all segmented or unsegmented reads, possibly to give them to  other software.
Runing Vidjil with =-U= gives a file =out/basename.unsegmented.vdj.fa=, with all segmented reads.
On datasets generated with rather specific V(D)J primers, this is generally not recommended, as it may generate a large file.
However, the =-U= option is very useful for whole RNA-Seq or capture datasets that contain few reads with V(D)J recombinations.

Similarly, two options are available to get the unsegmented reads:
   - =-u= gives a file =out/basename.segmented.vdj.fa=, with unsegmented reads.
   - =-uu= gives a set of files =out/basename.UNSEG_*=, with unsegmented reads gathered by unsegmentation cause

Again, as these options may generate large files, they are generally not recommended.
However, they are very useful in some situations, especially to understand why some dataset gives poor segmentation result.
For example =-uu -X 1000= splits the unsegemented reads from the 1000 first reads.
537

Mikaël Salson's avatar
Mikaël Salson committed
538

539
** Segmentation and .vdj format
540

541
Vidjil output includes segmentation of V(D)J recombinations. This happens
542 543
in the following situations:

544
- in a first pass, when requested with =-U= option, in a =.segmented.vdj.fa= file.
545 546

      The goal of this ultra-fast segmentation, based on a seed
547 548
      heuristics, is only to identify the locus and to locate the w-window overlapping the
      CDR3. This should not be taken as a real V(D)J designation, as
549 550 551
      the center of the window may be shifted up to 15 bases from the
      actual center.

552
- in a second pass, on the standard output and in both =.vidjil= and =.vdj.fa= files
553 554
        - at the end of the clones detection (default command =-c clones=,
          on a number of clones limited by the =-z= option)
555
        - or directly when explicitly requiring segmentation (=-c segment=)
556

557 558 559
      These V(D)J designations are obtained by full comparison (dynamic programming)
      with all germline sequences.

560 561
      Note that these designations are relatively slow to compute, especially
      for the IGH locus. However, they
562 563 564 565 566
      are not at the core of the Vidjil clone gathering method (which
      relies only on the 'window', see above).
      To check the quality of these designations, the automated test suite include
      sequences with manually curated V(D)J designations (see [[http://git.vidjil.org/blob/master/doc/should-vdj.org][should-vdj.org]]).

Mikaël Salson's avatar
Mikaël Salson committed
567 568

Segmentations of V(D)J recombinations are displayed using a dedicated
569
=.vdj= format. This format is compatible with FASTA format. A line starting
Mikaël Salson's avatar
Mikaël Salson committed
570 571
with a > is of the following form:

572
#+BEGIN_EXAMPLE
573
>name + VDJ  startV endV   startD endD   startJ  endJ   Vgene   delV/N1/delD5'   Dgene   delD3'/N2/delJ   Jgene   comments
Mikaël Salson's avatar
Mikaël Salson committed
574

575
        name          sequence name (include the number of occurrences in the read set and possibly other information)
Mikaël Salson's avatar
Mikaël Salson committed
576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598
        +             strand on which the sequence is mapped
        VDJ           type of segmentation (can be "VJ", "VDJ", 
    	              or shorter tags such as "V" for incomplete sequences).	
		      The following line are for "VDJ" recombinations :

        startV endV   start and end position of the V gene in the sequence (start at 0)
        startD endD                      ... of the D gene ...
        startJ endJ                      ... of the J gene ...

        Vgene         name of the V gene 

        delV          number of deletions at the end (3') of the V
        N1            nucleotide sequence inserted between the V and the D
        delD5'        number of deletions at the start (5') of the D

        Dgene         name of the D gene being rearranged

        delD3'        number of deletions at the end (3') of the D
        N2            nucleotide sequence inserted between the D and the J
        delJ          number of deletions at the start (5') of the J

        Jgene         name of the J gene being rearranged
        
599
        comments      optional comments. In Vidjil, the following comments are now used:
600
                      - "seed" when this comes for the first pass (.segmented.vdj.fa). See the warning above.
601
                      - "!ov x" when there is an overlap of x bases between last V seed and first J seed
602 603
                      - the name of the locus (TRA, TRB, TRG, TRD, IGH, IGL, IGK, possibly followed
                        by a + for incomplete/unusual recombinations)
Mikaël Salson's avatar
Mikaël Salson committed
604

605 606
#+END_EXAMPLE

Mikaël Salson's avatar
Mikaël Salson committed
607 608 609 610 611
Following such a line, the nucleotide sequence may be given, giving in
this case a valid FASTA file.

For VJ recombinations the output is similar, the fields that are not
applicable being removed:
Mikaël Salson's avatar
Mikaël Salson committed
612

613
#+BEGIN_EXAMPLE
614
>name + VJ  startV endV   startJ endJ   Vgene   delV/N1/delJ   Jgene  comments
615
#+END_EXAMPLE
616 617 618 619 620 621 622


* Examples of use

All the following examples are on a IGH VDJ recombinations : they thus
require either the =-G germline/IGH= option, or the multi-germline =-g germline= option.

623 624
** Basic usage: PCR-based datasets, with primers in the V(D)J regions (such as BIOMED-2 primers)

625
#+BEGIN_SRC sh
626
./vidjil -G germline/IGH -3 data/Stanford_S22.fasta
627
   # Gather the reads into clones, based on windows overlapping IGH CDR3s.
628
   # Assign the VDJ genes and try to detect the CDR3 of each clone.
629
   # Summary of clones is available both on stdout, in out/Stanford_S22.vdj.fa and in out/Stanford_S22.vidjil.
630 631
#+END_SRC

632
#+BEGIN_SRC sh
633
./vidjil -g germline -i -2 -3 data/reads.fasta
634
   # Detects for each read the best locus, including an analysis of incomplete/unusual and unexpected recombinations
635
   # Gather the reads into clones, again based on windows overlapping the detected CDR3s.
636
   # Assign the VDJ genes and try to detect the CDR3 of each clone.
637 638
   # Summary of clones is available both on stdout, in out/reads.vdj.fa and in out/reads.vidjil.
#+END_SRC
639 640


641
** Basic usage: Whole RNA-Seq or capture datasets
642 643

#+BEGIN_SRC sh
644 645
./vidjil -g germline -i -2 -U data/reads.fasta
   # Detects for each read the best locus, including an analysis of incomplete/unusual and unexpected recombinations
646
   # Gather the reads into clones, again based on windows overlapping the detected CDR3s.
647
   # Assign the VDJ genes and try to detect the CDR3 of each clone.
648
   # The out/reads.segmented.vdj.fa include all reads where a V(D)J recombination was found
649 650
#+END_SRC

651 652 653 654 655
Typical whole RNA-Seq or capture datasets may be huge (several GB) but with only a (very) small portion of CDR3s.
Using Vidjil with =-U= will create a =out/reads.segmented.vdj.fa= file
that includes all reads where a V(D)J recombination (or an unexpected recombination, with =-2=) was found.
This file will be relatively small (a few kB or MB) and can be taken again as an input for Vidjil or for other programs.

656

657 658
** Advanced usage

659 660
#+BEGIN_SRC sh
./vidjil -c clones -G germline/IGH -r 1 ./data/clones_simul.fa
661
   # Extracts the windows with at least 1 read each (-r 1, the default being -r 5)
662 663 664 665 666 667 668 669
   # then gather them into clones
#+END_SRC

#+BEGIN_SRC sh
./vidjil -c clones -G germline/IGH -r 1 -n 5 ./data/clones_simul.fa
   # Window extraction + clone gathering,
   # with automatic clustering, distance five (-n 5)
   # The result of the automatic clustering is in the .vidjil file
670
   # and can been seen/edited in the web application.
671 672 673
#+END_SRC

#+BEGIN_SRC sh
674 675
./vidjil -c segment -G germline/IGH -3 data/segment_S22.fa
   # Detailed V(D)J designation and CDR3 detection on all reads, without clone gathering
676
   # (this is slow and should only be used for testing, or on a small file)
677 678 679 680 681 682
#+END_SRC

#+BEGIN_SRC sh
./vidjil -c germlines file.fastq
   # Output statistics on the number of occurrences of k-mers of the different germlines
#+END_SRC