airr-S22.should 1.06 KB
Newer Older
1
!LAUNCH: $VIDJIL_DIR/$EXEC -c clones -z 2 -3 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta  > /dev/null ; cat out/Stanford_S22.tsv
2 3 4 5 6 7 8 9 10 11 12

$ There are four lines, all with tabs
4:
4:\t

$ The required AIRR fields are present
:v_call	d_call j_call
:sequence_id
:sequence	
:sequence_alignment	
:germline_alignment
Mathieu Giraud's avatar
Mathieu Giraud committed
13 14 15 16 17
:v_cigar d_cigar	j_cigar	
:junction
:junction_aa
:productive
:rev_comp
18

Mathieu Giraud's avatar
Mathieu Giraud committed
19 20 21 22 23 24
$ Optional AIRR fields
:duplicate_count

$ Custom AIRR fields
:warnings

25 26 27 28 29 30 31
$ Three clones on IGH
3:IGH

$ One clone has 8 reads, two clones have 5 reads
1:IGH 8
2:IGH 5

Mathieu Giraud's avatar
Mathieu Giraud committed
32 33 34 35
$ Two clones are productive, no clone is labeled as non-productive
2:\tT\t
0:\tF\t

36 37 38
$ v_call for 2 clones (-z 2)
2:IGHV

Mathieu Giraud's avatar
Mathieu Giraud committed
39 40
$ First clone window appears two times (sequence_id, sequence)
w2:TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
41

Mathieu Giraud's avatar
Mathieu Giraud committed
42 43 44 45
$ Junction of the first clone appears once, but CDR3 twice (it is also included in the junction)
1:CTREEQYSSWYFDFW		
w2:TREEQYSSWYFDF

46 47
$ The first clone has one warning
1:TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG .* W69
Mathieu Giraud's avatar
Mathieu Giraud committed
48

49 50 51 52 53
$ No spurious character
0:"
0:@
0:\\