Demo-X5.fa 4.89 KB
Newer Older
1 2 3 4 5 6 7 8 9 10 11 12
#
# Demo-X5 is a collection of sequences on all human locus, including some incomplete or unusual recombinations:
# IGH (VDJ, DJ), IGK (VJ, V-KDE, Intron-KDE), IGL, TRA, TRB (VJ, DJ), TRG and TRD (VDDJ, Dd2-Dd3, Vd-Ja).
# All these recombinations should be processed with: vidjil-algo -g germline/homo-sapiens.g -2 -3 -r 1
#
# Reference:
#  Marc Duez et al.,
#  “Vidjil: A web platform for analysis of high-throughput repertoire sequencing”,
#  PLOS ONE 2016, 11(11):e0166126
#  http://dx.doi.org/10.1371/journal.pone.0166126
#
#
13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29

### IGH: VDJ, DJ

# 0147-lil-IGH-TRG
>IGHV3-74*02 7/CCGCGGT/6 IGHD3-9*01 4/CTTCGAACA/7 IGHJ4*02  [IGH]
GGAGTCGGGGGGAGGCTTAGTTCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACTGGATGCACTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGTGTGGGTCTCACGTATTAATAGTGATGGGAGTAGCACAAGCTACGCGGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCTGTGTATTACTGCCGCGGTCGATATTTTGACTGGTTATTACTTCGAACATGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT

# 0215-ren-IGH+
>IGHD6-13*01 8/TCCCCCCCCCCT/6 IGHJ1*01 [IGH+]
ATACGAGATATGGACAGATTACGGTAGCAGAGACTTGGTCTTGACCCCAGCAAGGGAAGGCCCCCAAACAGACCAGGAGGTTTCTGAAGGTGTCTGTGTCACAGTGGGGTATAGCAGCA
TCCCCCCCCCCT
TACTTCCAGCACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAGGTAAG


### IGK: VJ, V-KDE, Intron-KDE

# 1043-IGK
30
>IGKV1-5*03 (9/4/1 IGKJ1*01, 9/7/4 IGKJ4*02)  [IGK]  {CQQYNRLWTF}
31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
CTCCTGCTACTCTGGCTCCCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCACCTGCCGGGCCAGTCAGAGTATTAATAACAACTTGGCCTGGTATCAGGAGAAGCCAGGGAAAGCCCCTAAGGTCCTGATCTATAAGGCGTCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACCTATTACTGCCAACAATATAATAGACTTTGGACGTTCGGCCAAGGGACCAAGGTGGAAGTCAAACGAACTGTGGCTGCACCATCT

# 0119-lil-IGK+-TRA+D-TRD+-TRG
>Intron 2/0/9 KDE  [IGK+]
CGTGGCACCGCGAGCTGTAGACAGAGCCGCGGTCTTTCTCGATTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCTGTGTCTGCCCGATTGATGCTGCCGTAGCCAGCTTTCCTGAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG

# 0119-lil-IGK+-TRA+D-TRD+-TRG
>IGKV3-7*04 1/GTGGA/11 KDE  [IGK+]
CCCAGGCTCCTCATCTATGATGCATCCACCAGGGCCACTAGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGGATTATAACTTACCTCGTGGAGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG


### IGL

# 1043-IGL
>IGLV2-14*01 12/4/0 IGLJ3*02  [IGL]
GGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGTCAGTAATCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCTTTCTTGGGTGTTCGGCGGAGGGACCAAGCTG


### TRA

# artificial sequence
>TRAV1-1*01 0//0 TRAJ1*01  [TRA]
tcttcattccttagtcgctctgatagttatggttacctccttctacaggagctccagatg
aaagactctgcctcttacttctgcgctgtgagaga
gtatgaaagtattacctcccagttgcaatttggcaaaggaaccagagtttccacttctcc


### TRB: VJ, DJ

# 0000-nck-TRB
>TRBV11-2*01 1/4/0 TRBJ2-7*01  [TRB]  {CASSLGPSYEQYF}
AACGGTGTAGTGGATGATTCACAGTTGCCTAAGGATCGATTTTCTGCAGAGAGGCTCAAAGGAGTAGACTCCACTCTCAAGATCCAGCCTGCAAAGCTTGAGGACTCGGCCGTGTATCTCTGTGCCAGCAGCTTAGGTCCCTCGTACGAGCAGTACTTCGGGCCGGGCACCAGGCTC


# 0000-nck-TRB+
66
>TRBD2 8/10/2 TRBJ2-7*01  [TRB+]
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97
CTGCGCTTCCTGCCGCTGCCcaGTGGTTGGGGGAGGGGGACtaGCAGGGAGGAAACATTTTTGTATcaTGGTGTAACATTGTGGGGACTAGTGTCAGTCCCCCTACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAGA


### TRG

# 0000-lil-lec-TRG
>TRGV10*02 5/AGAC/3 TRGJP1*01  [TRG]  {CAAWRPTGWFKIF}
ATCCTTACCATCAAGTCCGTAGAGAAAGAAGACATGGCCGTTTACTACTGTGCTGCGTGGAGACCCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTT


### TRD: VDDJ, Dd2-Dd3, Vd-Ja

# 0000-nck-TRD+-VDDJ
>TRDV1*01 2/TCTCGAT/2 TRDD2*01 0/CGT/0 TRDD3*01 3/CTCGGG/0 TRDJ1*01  [TRD]
CAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCCTTACAGCTAGAAGATTCAGCAAAGTACTTTTGTGCTCTTGGGGAATCTCGATTTCCTACCGTACTGGGGGATCTCGGGACACCGATAAACTCATCTTTGGAAAAGGAACCCGTGTGACTGTGGAAC

# 0000-nck-TRD+
>TRDD2 1/3/15 TRDD3  [TRD+]
Agcgggtggtgatggcaaagtgccaaggaaagggaaaaaggaagaagagggtttttatactgatgtgttt
CattgtgCCTTCCTATGG
cagtgctacaaaacctacagagacctgtacaaaaactgcaggggcaaaagtgccatttccctgggatatcctcaccctgggtcccatgcctcaggagacaaacacagcaagcagcttccctc

# 0000-nck-TRD+
>TRDV2 0/7/0 TRDD3  [TRD+]
GAAtcGAtAttGCAAAGAACCtGGCtGtACttAAGatACttGCACCAtCAGaGaGaGAtGAAGgGtCttACtACtGtGCCtGtGACACCCCCCtGTACtGGGGGAtACGCACAGtGCtACAAAACCtACAGAGACCtGTACAAAAACtGCAGGGGCAAAAGtGCCATttCCCtGGGAtAtCCtCACCCtGGGTCCCAA


# 0444-lil-TRA+D
>TRDV1*01 5//3 TRDD2*01 1//7 TRAJ29*01  [TRA+D] BUG
AGCGGGTGGTGATGGCAAATGCCAAGGAAGGGAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATTGTGGGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGTCCCAATGCAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCCTTACAGCTAGAAGATTCAG
CAAAGTACTTTTGTGCTCTTGGGTCCTAAGGAAACACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC