gosh-igh.should-vdj.fa 24.2 KB
Newer Older
1
#1473 vh1
Mikaël Salson's avatar
Mikaël Salson committed
2
>IGHV1-2*04 0/7/11 IGHD2-2*02 1/5/5 IGHJ6*03  [IGH]
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
GGTGCAGATCTCCTGCAGGCTTCTGGATACACCTTCACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACCCTAACAGTGGTGGCACAAACTATGCACAGAAGTTTCAGGGCTGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGAGAGTGGGGTAGTACCAGCTGCTATACGCCCGTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGTAAAA

#1473 vh3(s)
>IGHV3-23*01 15/10/5 IGHD6-6*01 2/8/5 IGHJ4*02  [IGH]
GCCTGGGATCATTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATACGTCGCCCTTTAGCAGCTCGTAGGATCTTTTTGACTACTGGGACCAGGGAACCCTGGTCACCGTCTCCTCAGGTA

#1473 vh3(l)
>IGHV3-53*01 2/9/10 IGHD3-10*01 4/8/1 IGHJ6*02  [IGH]
GCGGGTCGTCAGTAGCACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGACGTTTGTTGGGTTCGGGGAGTTATTAACCTTGGGTTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTA

#1473 vh4
>IGHV4-55*01 1/14/10 IGHD3-10*01 4/8/1 IGHJ6*02  [IGH]
GTATCTGCGCTGTCTCTGGTGACTCCATCAGCAGTGGTAACTGGTGAATCTGGGTCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGGAAATCCATCATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAATCACCATGTCCGTAGACACGTCCAAGAACCAGTTCTACCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGATTCCCACGTTTGTTGGGTTCGGGGAGTTATTAACCTTGGGTTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTA

#1469 vh3(s)
>IGHV3-15*01 0/13/5 IGHD6-13*01 2/4/4 IGHJ6*02  [IGH]
GCGGGATCCTTCGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAAGAGATGGGTAGAGCCCCTAGCAGCAGCTGCTTGATCTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGATCACCGTCTCCTCAGGTACA

#1469 vh3(l)
22 23 24 25 26 27
# sequence:  GAGAGCCCTGTATAGCAGCA
#            |||||
# IGHV3-30-3 GAGAGA   |||||||||||
# IGHD6-13          gggtatagcagcagctggtac
>IGHV3-30-3*01 1/5/2 IGHD6-13*01 3/0/0 IGHJ3*02  [IGH]
GCCATTGGGATCCGTTCGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCACTTATATCATATGATGGAAGCAATAAATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGCCCTGTATAGCAGCAGCTGGTGATGCTTTTGATATCTGGGGCCAAGGGACAATGGT
28 29 30 31 32 33 34 35 36 37 38 39 40 41

#1466 vh3
>IGHV3-64*01 1/23/7 IGHD1-1*01 3/0/6 IGHJ4*02  [IGH]
GGCTTATCCTTCGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATAGTGTTTCAGCTATTAGTAGTAATGGGGGTAGCACATATTATGCAAACTCTGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGGGCAGCCTGAGAGCTGAGGACATGGCTGTGTATTACTGTGCGAGAGGAGGGGCCCATGAGAAGCGATGTCTGGAACTTGACTACTGGGGCCAGGGAACGCTGGTCACCGTCTCCTCTAGTAGTACTAGTA

#1465 vh1
>IGHV1-69*01 0/8/0 IGHD3-16*01 30/8/22 IGHJ6*02  [IGH]
CGGGGTAGGTCTCTGCAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGATAAGGCCAGTATTATCCCGTGGAGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTA

#1465 vh6
>IGHV6-1*01 4/14/1 IGHD2-2*01 7/8/6 IGHJ6*02  [IGH]
CTCCTGTGCATCTCCGGGGACAGTGTCTCTAGCAACAGTGCTGCTTGGAACTGGATCAGGCAGTCCCCATCGAGAGGCCTTGAGTGGCTGGGAAGGACATACTACAGGTCCAAGTGGTATAATGATTATGCAGTATCTGTGAAAAGTCGAATAACCATCAACCCAGACACATCCAAGAACCAGTTCTCCCTGCAGCTGAACTCTGTGACTCCCGAGGACACGGCTGTGTATTACTGTGCAACGGGGGGTTCTGCGGGATATTGTAGTAGTACCAGCTGTCCCTCGGACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGT

#1465 dh3
42 43 44 45 46
#sequence:         TGGTATTACGATTTTCGGAGCCAGGGCCAAGGGACCACGGTCACCGTCTCCGCA
#                  ||||||||||||||| ||||
#IGHD3-3:          TGGTATTACGATTTTTGGAGTGGTTATTATACC
#                                         |||||||||||||||||||||||||||||||
#IGHJ6*02: ATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA
47
>IGHD3-3*01 (13/3/31, 18/8/31) IGHJ6*02  [IGH+] BUG
48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106
TCTGGCGTGATTTGGGGGGCAATTTATAAACCCAAAAGGACATGGCCATGCAGCGGGTAGGGACAATACAGACACGATATCAGCCTGAAATGGAGCCTCAGGGCACAGGTGGGCACGGACACTGTCCACCTAAGCCAGGGGCAGACCCGAGTGTCCCCGCAGTAGACCTGAGAGCGCTGGGCCCACAGCCTCCCCTCGGTGCCCTGCTACCTCCTCAGGTCAGCCCTGGACATCCCGGGTTTCCCCAGGCCTGGCGGTAGGTTTGGGGTGAGGTCTGTGTCACTGTGGTATTACGATTTTCGGAGCCAGGGCCAAGGGACCACGGTCACCGTCTCCGCAGGTAACC

#1463 vh3
>IGHV3-23*01 2/15/7 IGHD6-19*01 0/4/5 IGHJ6*02  [IGH]
CGGCATCTTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAACCTAGTAGGGGGAGCGCAGCTCGTCCTGAGTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTCAACGATGCTCTACGGTACGAGTTTCTACCGTAATAACGGTACTCACCACGGAGCTGCGGTCCCCCTACTAGGTTTGCAAGTGATATACGGAAATGTCCTCGGTTCTTAGGCTAATCGTCTGCCGATACAGCGTGTTTTTGGAAATTTACTCTGGACAATAGAGAATAGACCCTCACG

#1463 dh6
>IGHD6-19*01 3/6/2 IGHJ5*02  [IGH+]
AGAGGTTTCTGAGCTGTCTGTATCACAGTGGGGTATAGCAGTGGCTGGCCCCAAAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAACAAGGTTGCCAGGCCCGGGGTTCGAACCTTTTTAGGGCCGCCACTGCTGTACCCCACTGTGATACAGACGCTTACAGAACCTCCTCTTCTCTTTTAAGGAGCCGTCCCTTGCTGGGTCAAAA

#kw229 vh3
>IGHV3-11*01 5/11/0 IGHD2-15*01 5/10/0 IGHJ6*02  [IGH]
GGGGGGATCCTTCAGTGACTACTACATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGTGGTAGTACCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGGGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGGGGGGGGTGAGAGGATATTGTAGTGGTGGTAGCTGCTCCAACCCTCTATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGG

#kw229 dh3
>IGHD3-9*01 3/0/0 IGHJ5*02  [IGH+]
GCTCTGTGATTTGTGGGCAACTTATGAACCCGAAAGGACATGGCCATGGGGTGGGTAGGGACATAGGGACAGATGCCAGCCTGAGGTGGAGCCTCAGGACACAGGTGGGCACGGACACTATCCACATAAGCGAGGGATAGACCCGAGTGTCCCCACAGCAGACCTGAGAGCGCTGGGCCCACAGCCTCCCCTCAGAGCCCTGCTGCCTCCTCCGGTCAGCCCTGGACATCCCAGGTTTCCCCAGGCCTGCCGGTAGGTTTAGAATGAGGTCTGTGTCACTGTGGTATTACGATATTTTGACTGGTTATTATATTACTACTACTACTACGGTATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGTA

#kw228 dh3
>IGHD3-9*01 16/9/2 IGHJ6*03  [IGH+]
ATCTGTGATTTGTGGGCACTTATGAACCCGAAAGGACATGGCCATGGGGTGGGTAGGGACATAGGGACAGATGCCAGCCTGAGGTGGAGCCTCAGGACACAGGTGGGCACGGACACTATCCACATAAGCGAGGGATAGACCCGAGTGTCCCCACAGCAGACCTGAGAGCGCTGGGCCCACAGCCTCCCCTCAGAGCCCTGCTGCCTCCTCCGGTCAGCCCTGGACATCCCAGGTTTCCCCAGGCCTGCCGGTAGGTTTAGAATGAGGTCTGTGTCACTGTGGTATTACGATATTTTTTGTCCAACTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGTAATA

#kw228 dh6
>IGHD6-19*01 0/18/0 IGHJ4*02  [IGH+]
TGAGGTTTCTGAGCTGTCTGTATCACAGTGGGGTATAGCAGTGGCTGGTACGTGGTGCGGTGCGCCCCGACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAACACCC

#gos271 vh1
>IGHV1-46*01 IGHD2-21*02 IGHJ5*02  [IGH]
GCTGGCAGATTCTGCAGGCATCTGGATACACCTTCACCAGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAATAATCAACCCTAGTGGTGGTAGCACAAGCTACGCACAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGGTTTTCCTAGCATATTGTGGTGGTGACTGCTATTCGACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAAATT

#1428 vh1
>IGHV1-69*13 IGHD1-7*01 IGHJ6*02  [IGH]
CGGGGTAGTCTCCTGCAGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGGGGGGGCTGGAACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAAACTTATCCTTGGAAAGACGTCATCCGTAGTAGTAGTTCAGCCCCCCTGCCGTAATACAGGCCGTGTCTCGATCTCAGCGGCTCACTCCTGGTGGGCTGTGCTTGTGGAATTCTCCCGGTAATCGTGACTTTGCCCTGGAAATTCTATGCCTATTGTTGCTGGACC

#1428 vh2
>IGHV2-70*04 IGHJ6*02  [IGH]
CCACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAATGCGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACGCATTGATTGGGATGATGATAAATTCTACAGCACATCTCTGAAGACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGTTGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAAACCACGTCCTTGGCCCGACTCCATACCACACCTAATACCTGGCTGTGTCCACGAGGATCCATGGTTGGGCATTGTAGGACCACTGGTTTTTGGAAGTTCCCTTGAGAAAAGAAAAACAGAATCTTCAAAAAA

#1428 vh3
>IGHV3-30*18 IGHD3-22*01 IGHJ2*01  [IGH]
CGCCATGATCTTCGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAACCGAGACCCTAATTCCTTTTATTACTATGATAGTAGTGGTTATTTGGTACTTCGATCTCTGGGGCCGTGGCACCCTGGTCACCGTCTCCTCAGGTCAAACCAGGTGCAGGCGCATGATCGAAGTACAAATAACACTACTATCAAAGTAATAAAAGGGAATTATGGGTTCGGTTCCACGTTA

#1428 vh4
>IGHV4-31*03 IGHD1-7*01 IGHJ6*02  [IGH]
ATCTACTGCACTGTCTCTGGTGGCTCCATCAGCAGTGGTGGTTACTACTGGAGCTGGATCCGCCAGCACCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTACCATATCAGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTACTGTGCGGTGGGGGGGATCAACTGGAACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAAACCGTATCCTTGCGCAGACCTCATGCCGTCGTAATATTTCAGTTGATCCCCCCCACCGCAAATAATACAGGTCCTGGTTGCGCCTCAAAATTTTAACTTAGGGAGAAACTGGGTCTTAGAAG

#1416 vh1
>IGHV1-2*02 3/7/10 IGHD6-13*01 3/6/0 IGHJ5*02  [IGH]
TAGTCTCCTGCAGGCTTCTGGATACACCTTCACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGSACAAGGGCTTGAGTGGATGGGATGGATCAACCCTAACAGTGGTGGCACAAACTATGCACAGAAGTTTCAGGGCAGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGGCCAGAGGCAGCTGGGGGAGAACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTA

#1416 vh3
>IGHV3-30-3*01 0/10/1 IGHD6-13*01 3/6/0 IGHJ5*02  [IGH]
GTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGCAATAAATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGGGATAAAACGGTATAGCAGCAGCTGGGGGAGAACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTA

#1416 dh5
>IGHD5-18*01 5/12/15 IGHJ6*03  [IGH+]
ACCCCMTGTCCAGTCCTGGGGGCCCCTGGCACAGCTGTCTGGACCCTCTCTATTCCCTGGGAAGCTCCYCCTGACAGCCCCGCCTCCAGTTCCAGGTGTGGTTATTGTCAGGGGGTGTCAGACTGTGGTGGATACAGCTATGACCCCCCCAAAGACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGG

#1411 vh1
107 108 109 110
# sequence:    GTGTATTACTGTGCGGCATCCTCCTTGGTAGGTATTACTATGGTTCGGGGAGTTATTATAACTTTGACTACTGGGGCCAGGGAACGCTGGTCACCGTC
#              ||||||||||||||||||
# IGHV1-58*02  GTGTATTACTGTGCGGCAGA           |||||||||||||||||||||||||||||||
# IGHD3-10*01                                 GTATTACTATGGTTCGGGGAGTTATTATAAC
111
#                                                                          ||||||||||||||||||
112
# IGHJ4*02                                                              ACTACTTTGACTACTGGGGCC
113
>IGHV1-58*02 2/13/0 IGHD3-10*01 (2/0/3, 1/0/4, 0/0/5) IGHJ4*02  [IGH] BUG
114 115 116 117 118 119 120
CGGCAGTCTCCTGCAGGCTTCTGGATTCACCTTTACTAGCTCTGCTATGCAGTGGGTGCGACAGGCTCGTGGACAACGCCTTGAGTGGATAGGATGGATCGTCGTTGGCAGTGGTAACACAAACTACGCACAGAAGTTCCAGGAAAGAGTCACCATTACCAGGGACATGTCCACAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCCGAGGACACGGCCGTGTATTACTGTGCGGCATCCTCCTTGGTAGGTATTACTATGGTTCGGGGAGTTATTATAACTTTGACTACTGGGGCCAGGGAACGCTGGTCACCGTCTCCTCAGGTAAA

#1400 vh2
>IGHV2-5*10 2/11/11 IGHD2-2*02 0/6/0 IGHJ6*03  [IGH]
AAACAGACCCTCACGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAGTGGGTGTGGGCTGGATCCGTCAGCCCCCAGGAAAGGCCCTGGAGTGGCTTGCACTCATTTATTGGGATGATGATAAGCGCTACAGCCCATCTCTGAAGAGCAGGCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACACCGGCCCCGGGTAGTACCAGCTGCTATACCCTTAATATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG

#1400 vh3
Mikaël Salson's avatar
Mikaël Salson committed
121 122 123 124 125 126 127
# sequence:     GTGTATTACTGTGCGAGAGATAAAAGGGATTACTATGGTTCAGGGAGTTATTTTTGACTA
#               ||||||||||||||||||||        ||||||||||||| ||||||||||
# IGHV3-53*01:  GTGTATTACTGTGCGAGAGA
# IGHD3-10*01:                            GTATTACTATGGTTCGGGGAGTTATTATAAC
#                                                                   |||||||
# IGHJ4*02:                                                    ACTACTTTGACTACTGGGGCCAGGGAACCCTGG
>IGHV3-53*01 0/8/2 IGHD3-10*01 5/0/5 IGHJ4*02  [IGH]
128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273
GGGGCTCGTCAGTAGCACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGATAAAAGGGATTACTATGGTTCAGGGAGTTATTTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGG

#1387 vh3
>IGHV3-13*05 2/1/0 IGHD3-9*01 8/7/0 IGHJ3*01  [IGH]
GCTGGATCCTTCGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACCCATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAAGACGTATTACAATATTTTGACTGGTTCCCGGGATGATGCTTTTGATATCTGGGGCCAAGGGACAACGGTCATCGTCTCCTA

#1387 vh4
>IGHV4-59*01 0/5/3 IGHD4-17*01 0/16/1 IGHJ6*03  [IGH]
CCTAACTGCACTGTCTCTGGTGGCTCCATCAGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAGATCCCTACGGTGACTACGTACCTGAAACCTCTCTTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGT

#1383 vh3
>IGHV3-15*01 0/4/3 IGHD3-9*01 3/6/11 IGHJ6*03  [IGH]
GGCCTGCATCTTTCGTACGCCTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTATTAAAAGCAAAACTGATGGTGGGACAACAGACTACGCTGCACCCGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCAAAAAACACGCTGTATCTGCAAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTACCACAGATCCCTTACGATATTTTGACTGGTTATTATTAGTTGCTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGTACCAA

#1383 vh4
>IGHV4-31*03 3/5/3 IGHD3-9*01 3/6/11 IGHJ6*03  [IGH]
CTCTACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTGGTGGTTACTACTGGAGCTGGATCCGCCAGCACCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTACCATATCAGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTACTGTGCGAGGGGTCTTACGATATTTTGACTGGTTATTATTAGTTGCTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGTA

#1378 vh3
>IGHV3-13*01 1/14/7 IGHJ4*02  [IGH]
GCGGGATCCTTCGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCAAGAGTCTCTGGGACTTCGTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCAGCAGGTAAAA

#1383 dh3
>IGHD3-9*01 7/0/6 IGHJ4*02  [IGH+]
AGCTCTGCTGATTTGTGGGCACTTATGAACCCGAAAGGACATGGCCATGGGGTGGGTAGGGACATAGGGACAGATGCCAGCCTGAGGTGGAGCCTCAGGACACAGGTGGGCACGGACACTATCCACATAAGCGAGGGATAGACCCGAGTGTCCCCACAGCAGACCTGAGAGCGCTGGGCCCACAGCCTCCCCTCAGAGCCCTGCTGCCTCCTCCGGTCAGCCCTGGACATCCCAGGTTTCCCCAGGCCTGCCGGTAGGTTTAGAATGAGGTCTGTGTCACTGTGGTATTACGATATTTTGACTGGTTATTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTA

#1349 vh3
>IGHV3-23*01 1/15/5 IGHD3-10*01 0/2/0 IGHJ3*02  [IGH]
CGCCCCACTTGATATTCCTTTTAGCCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAAGGGTGGGAGGTATTAAACTATGGTTCGGGGAGTTATTATAACGTTGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAGGTAACTC

#1347 vh2
>IGHV2-26*01 0/5/5 IGHD5-24*01 4/13/7 IGHJ4*02  [IGH]
TCAGAGACCTCACGCTGACCTGCACCGTCTCTGGGTTCTCACTCAGCAATGCTAGAATGGGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACACATTTTTTCGAATGACAAAAAATCCTACAGCACATCTCTGAAGAGCAGGCTCACCATCTCCAAGGACACCTCCAAAAGCCAGGTGGTCCTTACCATGACCAATATGGACCCTGTGGACACAGCCACATATTACTGTGCATGGATACCCGAGGATGGCTACAACGACAAGAGCCAATGACTACTGGGGCCAGGGAACGCTGGTCACCGTCTCCTCAGGTAAATCCATGCACAGTAATATGTGGCTGTGTCCACAGGGTCCATATTGGTCATGGTAAGGACCACCTGGCTTTTGGAGGTGTCCTTGGAGA

#1339 vh3
>IGHV3-33*01 0/8/4 IGHD6-19*01 3/0/5 IGHJ4*02  [IGH]
GAACGGATAACTTCGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGATCGAAGTGATAGCAGTGGCTGGTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAA

#1339 dh2
>IGHD2-2*01 10/3/1 IGHJ6*02  [IGH+]
ATTAGACAAAAACCCCCTGGAATCATAGTATCAGCAGGAGAACTAGCCAGAGACAGCAAGAGGGGACTCAGTGACTCCCGCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGACCTTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGT

#1334 vh3
>IGHV3-13*01 5/6/0 IGHD7-27*01 1/16/11 IGHJ4*02  [IGH]
GGAATGATCCTTCGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACCCATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAGACACCCTAACTGGGGGGGGTTCCCTTGGGGGTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAA

#1334 dh2
>IGHD2-2*01 7/13/19 IGHJ6*02  [IGH+]
ATTAGACAAACCCCCTGGAATCATAGTATCAGCAGGAGAACTAGCCAGAGACAGCAAGAGGGGACTCAGTGACTCCCGCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGTCATATTCGGGGATATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTCAAACC

#1334 dh3
>IGHD3-9*01 5/13/11 IGHJ6*02  [IGH+]
GCTCTGTGATTTGTGGGCACTTATGAACCCGAAAGGACATGGCCATGGGGTGGGTAGGGACATAGGGACAGATGCCAGCCTGAGGTGGAGCCTCAGGACACAGGTGGGCACGGACACTATCCACATAAGCGAGGGATAGACCCGAGTGTCCCCACAGCAGACCTGAGAGCGCTGGGCCCACAGCCTCCCCTCAGAGCCCTGCTGCCTCCTCCGGTCAGCCCTGGACATCCCAGGTTTCCCCAGGCCTGGCGGTAGGTTTAGAATGAGGTCTGTGTCACTGTGGTATTACGATATTTTGACTGGTTATTGCGGCCCCTGAAGTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAGACGTGCCTCTTGGCCCAGACGTCATACGTAATACTTCAGGGCCGCAATAACCCGTCAAAATATCGTAAATACCCCCTGACCCAACCTCACTCTAAACT

#1318 vh3
>IGHV3-21*01 35/8/9 IGHJ6*02  [IGH]
CGGCATCCTTCGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTAGTAGTTACATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGACCTTTCTTCGAGGGACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCGTCAGGTA

#1317 vh3
>IGHV3-30-3*01 0/8/9 IGHD1-26*01 2/0/0 IGHJ5*02  [IGH]
GCGGGATACTTCAGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGCAATAAATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGATCCCATGGAGCTACTACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCGACAGGTATCAAACAACTGGTTCGACCCCTGGGGCCA

#1317 dh4
>IGHD4-11*01 8/14/2 IGHJ5*02  [IGH+]
GGGACAGACGCCTGGACAGGGCCTGCGTGGGAAGGCCTCTGGGCACACTCAGGGGCTTTTTGTGAAGGGTCCTCCTACTGTGTGACTACATTTAGGGTTGGGGTAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTA

#1317 dh5
>IGHD5-12*01 2/12/3 IGHD7-27*01 0/10/20 IGHJ5*02  [IGH+]
TCAGCCCCCAACGGTCCCCAGTCCTGGGGGCCCCTGGCTCAGCTGTCTGGACCCTCCCTGTTCCCTGGGAAGCTCCTCCTGACAGCCCCGCCTCCAGTTCCAGGTGTGGTTATTGTCAGGCGATGTCAGACTGTGGTGGATATAGTGGCTACGATTGGGTAAGATGTGACTGGGGATCCCTCGTGAGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAAA

#1309 vh3
>IGHV3-43*01 0/20/5 IGHD1-7*01 3/11/2 IGHJ4*02  [IGH]
CCCATGCATACTTTGATGATTATACCATGCACTGGGTCCGTCAAGCTCCGGGGAAGGGTCTGGAGTGGGTCTCTCTTATTAGTTGGGATGGTGGTAGCACATACTATGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACAGCAAAAACTCCCTGTATCTGCAAATGAACAGTCTGAGAACTGAGGACACCGCCTTGTATTACTGTGCAAAAGATATAGGAGGCGCGAGACGGAAAAACTGGAACCCGGAAGGGGGTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAA

#gos269 vh3
>IGHV3-30-3*01 IGHD3-9*01 IGHJ6*03  [IGH]
GCCAGGGATACTTCGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGCAATAAATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCCCGTAGGGCTGGTTATTATAACGTGGGATACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGTAA

#gos268 vh3
>IGHV3-30*18 0/5/0 IGHD4-11*01 0/2/0 IGHJ6*02  [IGH]
GGCAATTCATCCTTCGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAGAGGGGATGACTACAGTAACTACCAATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTA

#gos268 dh2
>IGHD2-2*01 5/11/11 IGHJ6*02  [IGH+]
GGGTTTCGGACAAAAACCCCCTGGAAATCATAGTATCAGCAGGAGAACTAGCCAGAGACAGCAAGAGGGGACTCAGTGACTCCCGCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGCTCGGGGGCCAGTTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGT

#gos268 dh4
>IGHD4-11*01 0/2/0 IGHJ6*02  [IGH+]
AGGGGCAAGAACGCCTGGACAGGGCCTGCGTGGGAAAGGCCTCTGGGCACACTCAGGGGCTTTTTGTGAAGGGTCCACAAAAAAGTGTGACTACAGTAACTACCAATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCCCGTCTCCTCAGGTA

#gos267 vh3
>IGHV3-13*01 2/17/3 IGHJ5*02  [IGH]
GGGGGGTCCTTCGGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAAGACCCCAGGAAAGAATCAGATTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTA

#gos265 vh3
>IGHV3-64*06 2/5/0 IGHD7-27*01 6/1/6 IGHJ4*02  [IGH]
GGGAATCCTTCGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAATGGGGGTAGCACATACTACGCAGACTCCGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAGCAGTCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGTGAAAAACCCCTAACCTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTA

#gos265 dh1
>IGHD1-20*01 2/15/0 IGHJ3*02  [IGH+]
GGGTTCGCTAGCTGGGGCCCCAGTGCTCACCCCACACCTAAAGCGAGCCCCAGCCTCCAGAGCCCCCTAAGCATTCCCCGCCCAGCAGCCCAGCCCCTGCCCCCACCCAGGAGGCCCCAGAGCTCAGGGCGCCTGGTCGGATTCTGAACAGCCCCGAGTCACAGTGGGTATAACTGGAACGGCTCTTCGGCCCCCTTGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAGG

#gos261 vh4
>IGHV4-30-4*01 30/5/7 IGHD1-26*01 7/6/3 IGHJ2*01  [IGH]
CCGTTCTACTGCACTGTCTCTGGTGGCTCCATCAGCAGTGGTGATTACTACTGGAGTTGGATCCGCCAGCCCCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCTTCCATGGGAGGGTCCGCTGGTACTTCGATCTCTGGGGCCGTGGCACCCTGGTCACCGTCTCCTCAGGT

#gos260 vh1
>IGHV1-8*01 0/12/9 IGHD2-8*01 5/7/5 IGHJ5*02  [IGH]
CTGTAGGACTCCTGCAGGCTTCTGGATACACCTTCACCAGTTATGATATCAACTGGGTGCGACAGGCCACTGGACAAGGGCTTGAGTGGATGGGATGGATGAACCCTAACAGTGGTAACACAGGCTATGCACAGAAGTTCCAGGGCAGAGTCACCATGACCAGGAACACCTCCATAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGGGGGGGAGAAAAATACTAATGGTGTATGCTCCCCAGGTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAAAAA

#gos260 vh3
>IGHV3-33*01 1/15/8 IGHD4-17*01 3/5/4 IGHJ5*02  [IGH]
GGGGGATCCTTCGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCCCCGGGCGTGACGCGTGACGGGGGCTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAA

#kw226 vh1
>IGHV1-NL1*01 1/10/6 IGHD6-19*01 0/8/5 IGHJ6*02  [IGH]
CGGTCAAGGTCTCCTGCCAGGCTTCCAGATACACCTTCACCAAATACTTTACACAGTGGGTGCGACAGGGCCCTGGACAAGGGCATAGTGGTTGGGATGCATCAACCCTTACAATGATAACACACACTACGCACAGAAGTTCCGGGGCAGAGTCACCATTACCAGTGACAGGTCTGTGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACATGGTCGTGTATTCCTGTGTGAGAGTGGGCGCTACAGCAGTGGCTGGTACAGCAAGGGTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTACCT

#kw226 dh2
>IGHD2-2*02 2/6/0 IGHJ6*02  [IGH+]
ATTCGACAAAACCCCCTGGAATCATAGTATCAGCAGGAGAACTAGCCAGAGACAGCAAGAGGGGACTCAGTGACTCCCGCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGCTATAGAGGGGATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTA

#kw224 vh3(s)
>IGHV3-13*01 0/11/9 IGHD6-19*01 1/2/3 IGHJ4*02  [IGH]
GGGGGGATCCCTTCGGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAAGAGATTAGAAGAAGGAGTGGCTGGTAGCACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCGATCAGGTAAAAC

#kw224 vh3(l)
>IGHV3-21*01 15/5/15 IGHD2-2*01 2/37/2 IGHJ5*02  [IGH]
GCTTGGAATCCTTCGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTAGTAGTTACATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTACTTCTTACCAGCTGCTATGAGGGGGCGACCAGACCGGCGCGTAGTTCTCGGGGGGGAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCGCAGGTA

#kw223 vh2
>IGHV2-5*01 4/6/6 IGHD6-6*01 0/1/8 IGHJ4*02  [IGH]
TTCCACAGACCCTCACGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAGTGGGTGTGGGCTGGATCCGTCAGCCCCCAGGAAAGGCCCTGGAGTGGCTTGCACTCATTTATTGGAATGATGATAAGCGCTACAGCCCATCTCTGAAGAGCAGGCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACTCCTTTGAAGCAGCTCGTCCGGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCGTCAGGTAAAA

#kw222 vh3
>IGHV3-13*01 6/9/12 IGHD2-2*01 3/4/0 IGHJ6*02  [IGH]
CGCATCCTTCGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCCCTCCGACCTAGTACCAGCTGCTATCCCTATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGT

#kw221 vh3
>IGHV3-19*01 14/6/2 IGHD3-10*01 6/0/2 IGHJ4*02  [IGH]
GGAATGAATCCTTCGTACTTGACATGAACTGGGTCCGCCAGGCTCCAGGAAAGGGGCTGGAGTGGGTATCGGGTGTTACTTATAATGGAAGTAGGACGCACTATGCAGACTCTGTAAAGGGCCGATTCATCATCTCCAGAGACAATTCCAGGAACTTCCTGTATCAGCAAATGAACAGCCTGAGGCCCGAGGACATGGCTGTGTATCCTTGAATTACTATGGTTCGGGGAGTTATTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACAGTCTCCTCAGGTCAAACCTGGTATTATACGGACGGCAGTTCTCACTCTCCGCTGGACCTTTGCCATCAGCGTGTTCTTGGAATTGCCCCTGGACCTGGTTGAATGTTACTTAACAAACCCTCA

#kw220 vh3
>IGHV3-30*18 0/9/7 IGHD3-22*01 9/13/5 IGHJ4*02  [IGH]
GGATTGGAAAACTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAGATGGTTTCCTTATGATAGTAGTGGTCCCCCCCTCCTTTTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAACCC