vidjil-algo.md 42.3 KB
Newer Older
1 2 3
# vidjil-algo 2018.07
**Command-line manual**

4
*The Vidjil team (Mathieu, Mikaël, Aurélien, Florian, Marc, Tatiana and Rayan)*
Mikaël Salson's avatar
Mikaël Salson committed
5

6 7 8 9 10 11 12 13 14 15
```
  Vidjil -- High-throughput Analysis of V(D)J Immune Repertoire -- [[http://www.vidjil.org]]
  Copyright (C) 2011-2018 by Bonsai bioinformatics
  at CRIStAL (UMR CNRS 9189, Université Lille) and Inria Lille
  contact@vidjil.org
```

This is the help of vidjil-algo, for command-line usage.
This manual can be browsed online:

16 17
 - <http://www.vidjil.org/doc/vidjil-algo>                (last stable release)
 - <http://gitlab.vidjil.org/blob/dev/doc/vidjil-algo.md> (development version)
18 19 20 21 22 23 24

Other documentation (users and administrators of the web application, developpers) can be found from <http://www.vidjil.org/doc/>.


## About

*V(D)J recombinations* in lymphocytes are essential for immunological
Mikaël Salson's avatar
Mikaël Salson committed
25 26 27
diversity. They are also useful markers of pathologies, and in
leukemia, are used to quantify the minimal residual disease during
patient follow-up.
Mikaël Salson's avatar
Mikaël Salson committed
28

29
Vidjil-algo processes high-throughput sequencing data to extract V(D)J
30
junctions and gather them into clones. Vidjil-algo starts
Mikaël Salson's avatar
Mikaël Salson committed
31 32
from a set of reads and detects "windows" overlapping the actual CDR3.
This is based on an fast and reliable seed-based heuristic and allows
33
to output all sequenced clones. The analysis is extremely fast
Mathieu Giraud's avatar
Mathieu Giraud committed
34
because, in the first phase, no alignment is performed with database
35
germline sequences. At the end, only the consensus sequences
36
of each clone have to be analyzed. Vidjil-algo can also cluster similar
37
clones, or leave this to the user after a manual review in the web application.
Mikaël Salson's avatar
Mikaël Salson committed
38

39 40
The method is described in the following references:

41
- Marc Duez et al.,
42
“Vidjil: A web platform for analysis of high-throughput repertoire sequencing”,
43
PLOS ONE 2016, 11(11):e0166126
44
<http://dx.doi.org/10.1371/journal.pone.0166126>
Mikaël Salson's avatar
Mikaël Salson committed
45

46
- Mathieu Giraud, Mikaël Salson, et al.,
Mikaël Salson's avatar
Mikaël Salson committed
47
"Fast multiclonal clusterization of V(D)J recombinations from high-throughput sequencing",
48
BMC Genomics 2014, 15:409
49
<http://dx.doi.org/10.1186/1471-2164-15-409>
Mikaël Salson's avatar
Mikaël Salson committed
50

51
Vidjil-algo is open-source, released under GNU GPLv3 license.
Mikaël Salson's avatar
Mikaël Salson committed
52

53
# Requirements and installation
54

55
## Supported platforms
Mikaël Salson's avatar
Mikaël Salson committed
56

57
Vidjil-algo has been successfully tested on the following platforms :
58 59 60 61 62 63 64 65 66 67 68

  - CentOS 6.3 amd64
  - CentOS 6.3 i386
  - CentOS 7.2 i386
  - Debian Squeeze 6.0
  - Debian Wheezy 7.0 amd64
  - Fedora 19
  - FreeBSD 9.2
  - Ubuntu 12.04 LTS amd64
  - Ubuntu 14.04 LTS amd64
  - Ubuntu 16.04 LTS
69
  - Ubuntu 18.04 LTS
70
  - OS X 10.9, 10.10, 10.11
Mikaël Salson's avatar
Mikaël Salson committed
71

72
Vidjil-algo is developed with continuous integration using systematic unit and functional testing.
73
The development team internally uses [Gitlab CI](http://gitlab.vidjil.org/pipelines) and [Jenkins](https://jenkins-ci.org/) for that.
Mikaël Salson's avatar
Mikaël Salson committed
74

75
## Build requirements (optional)
76

77
This paragraph details the requirements to build Vidjil-algo from source.
78
You can also download a static binary, see [installation](#installation).
79

80
To compile Vidjil-algo, make sure:
81

82
  - to be on a POSIX system ;
83
  - to have a C++11 compiler (as `g++` 4.8 or above, or `clang` 3.3 or above).
84 85
  - to have the `zlib` installed (`zlib1g-dev` package under Debian/Ubuntu,
    `zlib-devel` package under Fedora/CentOS).
86

87
### CentOS 6
88 89 90

g++-4.8 is included in the devtools 2.0.

91
``` bash
92
sudo wget http://people.centos.org/tru/devtools-2/devtools-2.repo -O /etc/yum.repos.d/devtools-2.repo
93 94 95 96
sudo yum install devtoolset-2-gcc devtoolset-2-binutils devtoolset-2-gcc-c++ devtoolset-2-valgrind

# scl enable devtoolset-2 bash     # either open a shell running devtools
source /opt/rh/devtoolset-2/enable # ... or source devtools in the same shell
97
```
98

99
### CentOS 7.2
100 101 102

g++-4.8 is included.

103
### FreeBSD 9.2
104 105 106

g++-4.8 is included in FreeBSD 9.2.

107 108 109
You may also need to install the `gzstream` library with:

``` bash
110
pkg install gzstream
111
```
112

113 114
Also Vidjil-algo uses GNU make which requires `gmake` under FreeBSD.
At the time of redacting the documentation, `g++` requires extra options to
115
ensure flawless compilation and execution of Vidjil-algo:
116 117

``` bash
118
make MAKE=gmake CXXFLAGS="-std=c++11 -O2 Wall -D_GLIBCXX_USE_C99 -Wl,-rpath=/usr/local/lib/gcc49"
119 120 121 122 123 124
```

The `gcc49` at the end of the command line is to be replaced by the `gcc` version
used.

### Debian Squeeze 6.0 / Wheezy 7.0
125 126

g++-4.8 should be pinned from testing.
127
Put in `/etc/apt/preferences` the following lines:
128

129
``` bash
130
Package: *
131
Pin: release n=wheezy # (or squeeze)
132 133 134 135 136
Pin-Priority: 900

Package: g++-4.8, gcc-4.8, valgrind*
Pin: release n=jessie
Pin-Priority: 950
137
```
138 139 140

Then g++ 4.8 can be installed.

141
``` bash
142
apt-get update
143
apt-get install -t jessie g++-4.8 valgrind
144
```
145

146
### Ubuntu 14.04 LTS
147

148
``` bash
149
sudo apt-get install g++-4.8
150
```
151

152
### Ubuntu 12.04 LTS
153 154 155

g++-4.8 is included in the devtools 2.0.

156
``` bash
157 158 159 160
sudo apt-get install python-software-properties
sudo add-apt-repository ppa:ubuntu-toolchain-r/test
sudo apt-get update
sudo apt-get install g++-4.8
161
```
162

163
### OS X
Mathieu Giraud's avatar
Mathieu Giraud committed
164 165 166

Xcode should be installed first.

167
## Installation
Mathieu Giraud's avatar
Mathieu Giraud committed
168

169 170 171 172 173
### Download

Stables releases can be downloaded from <http://www.vidjil.org/releases> or <http://bioinfo.lifl.fr/vidjil/>.
Development code is found at <http://gitlab.vidjil.org>.

174
### Compiling
Mikaël Salson's avatar
Mikaël Salson committed
175

176 177
Running `make` from the extracted archive should be enough to install vidjil-algo with germline and demo files.
It runs the three following `make` commands.
178

179
``` bash
Mikaël Salson's avatar
Mikaël Salson committed
180

181
make germline
Mathieu Giraud's avatar
Mathieu Giraud committed
182
   # get IMGT germline databases (IMGT/GENE-DB) -- you have to agree to IMGT license: 
Mikaël Salson's avatar
Mikaël Salson committed
183 184 185 186 187 188
   # academic research only, provided that it is referred to IMGT®,
   # and cited as "IMGT®, the international ImMunoGeneTics information system® 
   # http://www.imgt.org (founder and director: Marie-Paule Lefranc, Montpellier, France). 
   # Lefranc, M.-P., IMGT®, the international ImMunoGeneTics database,
   # Nucl. Acids Res., 29, 207-209 (2001). PMID: 11125093

189

190
make vijdil-algo         # build vijil-algo from the sources (see the requirements,
191 192
                         # another option is: wget http://www.vidjil.org/releases/vidjil-algo-latest_x86_64 -O vidjil-algo
                         # to download a static binary (built for x86_64 architectures)
193

194
make demo                # download demo files (S22 and L4, see demo/get-sequences)
195

196
./vidjil-algo -h         # display help/usage
197
```
Mikaël Salson's avatar
Mikaël Salson committed
198

199
On some older systems you may need to replace the `make` commands with:
200

201
``` bash
202
make LDFLAGS='-stdlib=libc++'  ### OS X Mavericks
203 204 205
```

## Self-tests (optional)
206 207 208

You can run the tests with the following commands:

209
``` bash
210
make -C src/tests/data
Mathieu Giraud's avatar
Mathieu Giraud committed
211
   # get IGH recombinations from a single individual, as described in:
212 213 214 215
   # Boyd, S. D., and al. Individual variation in the germline Ig gene
   # repertoire inferred from variable region gene rearrangements. J
   # Immunol, 184(12), 6986–92.

216
make -C src test                # run self-tests (can take 5 to 60 minutes)
217
```
Mikaël Salson's avatar
Mikaël Salson committed
218

219
# Input and parameters
220

221 222 223
The main input file of Vidjil-algo is a *set of reads*, given as a `.fasta`
or `.fastq` file, possibly compressed with gzip (`.gz`).
This set of reads can reach several gigabytes and 2\*10<sup>9</sup> reads. It is
224
never loaded entirely in the memory, but reads are processed one by
225 226
one by Vidjil-algo.
Vidjil-algo can also process BAM files, but please note that:
227

228 229 230 231 232 233
1.  The reads don't need to be aligned beforehand.
2.  In case of paired-end sequencing, the reads must have already been merged
    in the BAM file.

The `-h` and `-H` help options provide the list of parameters that can be
used. We detail here the options of the main `-c clones` command.
234 235 236 237 238 239

The default options are very conservative (large window, no further
automatic clusterization, see below), leaving the user or other
software making detailed analysis and decisions on the final
clustering.

240
## Recombination / locus selection
241

242 243

``` diff
244 245 246 247 248 249 250 251 252 253 254 255
Germline presets (at least one -g or -V/(-D)/-J option must be given)
  -g GERMLINES ...
         -g <.g FILE>(:FILTER)
                    multiple locus/germlines, with tuned parameters.
                    Common values are '-g germline/homo-sapiens.g' or '-g germline/mus-musculus.g'
                    The list of locus/recombinations can be restricted, such as in '-g germline/homo-sapiens.g:IGH,IGK,IGL'
         -g PATH
                    multiple locus/germlines, shortcut for '-g PATH/homo-sapiens.g',
                    processes human TRA, TRB, TRG, TRD, IGH, IGK and IGL locus, possibly with some incomplete/unusal recombinations
  -V FILE ...                 custom V germline multi-fasta file(s)
  -D FILE ...                 custom D germline multi-fasta file(s), segment into V(D)J components
  -J FILE ...                 custom V germline multi-fasta file(s)
256 257

Locus/recombinations
258 259
  -d                          try to detect several D (experimental)
  -2                          try to detect unexpected recombinations (must be used with -g)
260
```
261

262
The `germline/*.g` presets configure the analyzed recombinations.
263 264
The following presets are provided:

265
  - `germline/homo-sapiens.g`: Homo sapiens, TR (`TRA`, `TRB`, `TRG`, `TRD`) and Ig (`IGH`, `IGK`, `IGL`) locus,
266
    including incomplete/unusal recombinations (`TRA+D`, `TRB+`, `TRD+`, `IGH+`, `IGK+`, see [locus](locus)).
267 268 269 270 271
  - `germline/homo-sapiens-isotypes.g`: Homo sapiens heavy chain locus, looking for sequences with, on one side, IGHJ (or even IGHV) genes,
    and, on the other side, an IGH constant chain.
  - `germline/homo-sapiens-cd.g`: Homo sapiens, common CD genes (experimental, does not check for recombinations)
  - `germline/mus-musculus.g`: Mus musculus (strains BALB/c and C57BL/6)
  - `germline/rattus-norvegicus.g`: Rattus norvegicus (strains BN/SsNHsdMCW and Sprague-Dawley)
272

273
New `germline/*.g` presets for other species or for custom recombinations can be created, possibly referring to other `.fasta` files.
274 275
Please contact us if you need help in configuring other germlines.

276 277 278 279
  - Recombinations can be filtered, such as in
    `-g germline/homo-sapiens.g:IGH` (only IGH, complete recombinations),
    `-g germline/homo-sapiens.g:IGH,IGH+` (only IGH, as well with incomplete recombinations)
    or `-g germline/homo-sapiens.g:TRA,TRB,TRG` (only TR locus, complete recombinations).
280

281
  - Several presets can be loaded at the same time, as for instance `-g germline/homo-sapiens.g -g germline/germline/homo-sapiens-isotypes.g`.
282

283
  - Using `-2` further test unexpected recombinations (tagged as `xxx`), as in `-g germline/homo-sapiens.g -2`.
284

285
Finally, the advanced `-V/(-D)/-J` options enable to select custom V, (D) and J repertoires given as `.fasta` files.
286

287
## Main algorithm parameters
288

289
``` diff
290 291 292 293 294 295 296 297 298 299
Recombination detection ("window" prediction, first pass)
    (use either -s or -k option, but not both)
    (using -k option is equivalent to set with -s a contiguous seed with only '#' characters)
    (all these options, except -w, are overriden when using -g)
  -k INT                      k-mer size used for the V/J affectation (default: 10, 12, 13, depends on germline)
  -w INT                      w-mer size used for the length of the extracted window ('all': use all the read, no window clustering)
  -e FLOAT=1                  maximal e-value for determining if a V-J segmentation can be trusted
  -t INT                      trim V and J genes (resp. 5' and 3' regions) to keep at most <INT> nt  (0: no trim)
  -s SEED=10s                 seed, possibly spaced, used for the V/J affectation (default: depends on germline), given either explicitely or by an alias
                              10s:#####-##### 12s:######-###### 13s:#######-###### 9c:#########
300
```
Mathieu Giraud's avatar
Mathieu Giraud committed
301

302
The `-s`, `-k` are the options of the seed-based heuristic that detects
Mathieu Giraud's avatar
Mathieu Giraud committed
303 304
"junctions", that is a zone in a read that is similar to V genes on its
left end and similar to J genes in its right end. A detailed
305
explanation can be found in (Giraud, Salson and al., 2014).
306 307
*These options are for advanced usage, the defaults values should work.*
The `-s` or `-k` option selects the seed used for the k-mer V/J affectation.
Mathieu Giraud's avatar
Mathieu Giraud committed
308

309 310
The `-w` option fixes the size of the "window" that is the main
identifier to cluster clones. The default value (`-w 50`) was selected
311
to ensure a high-quality clone clustering: reads are clustered when
312
they *exactly* share, at the nucleotide level, a 50 bp-window centered
313 314
on the CDR3. No sequencing errors are corrected inside this window.
The center of the "window", predicted by the high-throughput heuristic, may
Mikaël Salson's avatar
Mikaël Salson committed
315
be shifted by a few bases from the actual "center" of the CDR3 (for TRG,
Mathieu Giraud's avatar
Mathieu Giraud committed
316
less than 15 bases compared to the IMGT/V-QUEST or IgBlast prediction
317
in \>99% of cases when the reads are large enough). Usually, a 50 bp-window
318 319
fully contains the CDR3 as well as some part of the end of the V and
the start of the J, or at least some specific N region to uniquely identify the clone.
Mathieu Giraud's avatar
Mathieu Giraud committed
320

321
Setting `-w` to higher values (such as `-w 60` or `-w 100`) makes the clone clustering
322 323 324 325 326
even more conservative, enabling to split clones with low specificity (such as IGH with very
large D, short or no N regions and almost no somatic hypermutations). However, such settings
may "segment" (analyze) less reads, depending on the read length of your data, and may also
return more clones, as any sequencing error in the window is not corrected.

327
The special `-w all` option takes all the read as the windows, completely disabling
328 329 330
the clustering by windows and generally returning more clones. This should only be used on
datasets where reads of the same clone do have exactly the same length.

331
Setting `-w` to lower values than 50 may "segment" (analyze) a few more reads, depending
332
on the read length of your data, but may in some cases falsely cluster reads from
333
different clones.
334 335
For VJ recombinations, the `-w 40` option is usually safe, and `-w 30` can also be tested.
Setting `-w` to lower values is not recommended.
Mathieu Giraud's avatar
Mathieu Giraud committed
336

337 338
When the read is too short too extract the requested length, the window can be shifted
(at most 10 bp) or shrinkened (down until 30bp) by increments of 5bp. Such reads
339
are counted in `SEG changed w` and the corresponding clones are output with the `Wxx` warning.
340

341
The `-e` option sets the maximal e-value accepted for segmenting a sequence.
342
It is an upper bound on the number of exepcted windows found by chance by the seed-based heuristic.
343 344
The e-value computation takes into account both the number of reads in the
input sequence and the number of locus searched for.
345 346
The default value is 1.0, but values such as 1000, 1e-3 or even less can be used
to have a more or less permissive segmentation.
347
The threshold can be disabled with `-e all`.
348

349
The `-t` option sets the maximal number of nucleotides that will be indexed in
350 351
V genes (the 3' end) or in J genes (the 5' end). This reduces the load of the
indexes, giving more precise window estimation and e-value computation.
352
However giving a `-t` may also reduce the probability of seeing a heavily
353
trimmed or mutated V gene.
354
The default is `-t 0`.
355

356
## Thresholds on clone output
357 358 359

The following options control how many clones are output and analyzed.

360
``` diff
361
Limits to report a clone (or a window)
362 363 364 365 366 367 368 369 370 371
  --max-clones INT            maximal number of output clones ('all': no maximum, default)
  -r INT=5                    minimal number of reads supporting a clone
  --ratio FLOAT=0             minimal percentage of reads supporting a clone

Limits to further analyze some clones (second pass)
  -y INT=100                  maximal number of clones computed with a consensus sequence ('all': no limit)
  -z INT=100                  maximal number of clones to be analyzed with a full V(D)J designation ('all': no limit, do not use)
  -A                          reports and segments all clones (-r 0 --ratio 0 -y all -z all), to be used only on very small datasets (for example -AX 20)
  -x INT                      maximal number of reads to process ('all': no limit, default), only first reads
  -X INT                      maximal number of reads to process ('all': no limit, default), sampled reads
372
```
373

374
The `-r/--ratio` options are strong thresholds: if a clone does not have
375
the requested number of reads, the clone is discarded (except when
376 377 378 379
using `-l`, see below).
The default `-r 5` option is meant to only output clones that
have a significant read support. **You should use** `-r 1` **if you
want to detect all clones starting from the first read** (especially for
380 381
MRD detection).

382 383
The `--max-clones` option limits the number of output clones, even without consensus sequences.

384
The `-y` option limits the number of clones for which a consensus
385
sequence is computed. Usually you do not need to have more
386
consensus (see below), but you can safely put `-y all` if you want
387
to compute all consensus sequences.
388

389 390
The `-z` option limits the number of clones that are fully analyzed,
*with their V(D)J designation and possibly a CDR3 detection*,
391
in particular to enable the web application
392
to display the clones on the grid (otherwise they are displayed on the
393
'?/?' axis).
394 395
If you want to analyze more clones, you should use `-z 200` or
`-z 500`. It is not recommended to use larger values: outputting more
396
than 500 clones is often not useful since they can not be visualized easily
397
in the web application, and takes more computation time.
398

399
Note that even if a clone is not in the top 100 (or 200, or 500) but
400
still passes the `-r`, `--ratio` options, it is still reported in both the `.vidjil`
401
and `.vdj.fa` files. If the clone is at some MRD point in the top 100 (or 200, or 500),
Mikaël Salson's avatar
Mikaël Salson committed
402
it will be fully analyzed/segmented by this other point (and then
403
collected by the `fuse.py` script, using consensus sequences computed at this
404
other point, and then, on the web application, correctly displayed on the grid).
405 406
**Thus is advised to leave the default** `-z 100` **option
for the majority of uses.**
407

408
The `-A` option disables all these thresholds. This option should be
409 410 411
used only for test and debug purposes, on very small datasets, and
produce large file and takes huge computation times.

412
The `-Z` option speeds up the full analysis by a pre-processing step,
Mathieu Giraud's avatar
Mathieu Giraud committed
413 414 415
again based on k-mers, to select a subset of the V germline genes to be compared to the read.
The option gives the typical size of this subset (it can be larger when several V germlines
genes are very similar, or smaller when there are not enough V germline genes).
416 417 418
The default `-Z 3` is generally safe.
Setting `-Z all` removes this pre-processing step, running a full dynamic programming
with all germline sequences that is much slower.
Mikaël Salson's avatar
Mikaël Salson committed
419

420
## Sequences of interest
421

422
Vidjil-algo allows to indicate that specific sequences should be followed and output,
423
even if those sequences are 'rare' (below the `-r/--ratio` thresholds).
424 425
Such sequences can be provided either with `-W <sequence>`, or with `-l <file>`.
The file given by `-l` should have one sequence by line, as in the following example:
Mikaël Salson's avatar
Mikaël Salson committed
426

427
``` diff
428 429
GAGAGATGGACGGGATACGTAAAACGACATATGGTTCGGGGTTTGGTGCT my-clone-1
GAGAGATGGACGGAATACGTTAAACGACATATGGTTCGGGGTATGGTGCT my-clone-2 foo
430
```
431

432 433 434
Sequences and labels must be separed by one space.
The first column of the file is the sequence to be followed
while the remaining columns consist of the sequence's label.
435
In Vidjil-algo output, the labels are output alongside their sequences.
436

437 438
A sequence given `-W <sequence>` or with `-l <file>` can be exactly the size
of the window (`-w`, that is 50 by default). In this case, it is guaranteed that
439 440
such a window will be output if it is detected in the reads.
More generally, when the provided sequence differs in length with the windows
441 442
we will keep any windows that contain the sequence of interest or, conversely,
we will keep any window that is contained in the sequence of interest.
443 444 445
This filtering will work as expected when the provided sequence overlaps
(at least partially) the CDR3 or its close neighborhood.

446
With the `-F` option, *only* the windows related to the given sequences are kept.
447
This allows to quickly filter a set of reads, looking for a known sequence or window,
448 449
with the `-FaW <sequence>` options:
All the reads with the windows related to the sequence will be extracted to `out/seq/clone.fa-1`.
450

451
## Clone analysis: VDJ assignation and CDR3 detection
452

453
The `-3` option launches a CDR3/JUNCTION detection based on the position
454
of Cys104 and Phe118/Trp118 amino acids. This detection relies on alignment
455
with gapped V and J sequences, as for instance, for V genes, IMGT/GENE-DB sequences,
456
as provided by `make germline`.
457 458
The CDR3/JUNCTION detection won't work with custom non-gapped V/J repertoires.

Mathieu Giraud's avatar
Mathieu Giraud committed
459 460
CDR3 are reported as productive when they come from an in-frame recombination
and when the sequence does not contain any in-frame stop codons.
461

462
The advanced `-f` option sets the parameters used in the comparisons between
463 464
the clone sequence and the V(D)J germline genes. The default values should work.

465 466
The e-value set by `-e` is also applied to the V/J designation.
The `-E` option further sets the e-value for the detection of D segments.
467

468
## Further clustering (experimental)
469

470 471
The following options are experimental and have no consequences on the `.vdj.fa` file,
nor on the standard output. They instead add a `clusters` sections in the `.vidjil` file
472
that will be visualized in the web application.
473

474 475
The `-n` option triggers an automatic clustering using DBSCAN algorithm (Ester and al., 1996).
Using `-n 5` usually cluster reads within a distance of 1 mismatch (default score
476 477
being +1 for a match and -4 for a mismatch). However, more distant reads can also
be clustered when there are more than 10 reads within the distance threshold.
478
This behaviour can be controlled with the `-N` option.
Mikaël Salson's avatar
Mikaël Salson committed
479

480
The `-=` option allows to specify a file for manually clustering two windows
Mikaël Salson's avatar
Mikaël Salson committed
481
considered as similar. Such a file may be automatically produced by vidjil
482 483
(`out/edges`), depending on the option provided. Only the two first columns
(separed by one space) are important to vidjil, they only consist of the
Mikaël Salson's avatar
Mikaël Salson committed
484
two windows that must be clustered.
Mikaël Salson's avatar
Mikaël Salson committed
485

486
# Output
Mikaël Salson's avatar
Mikaël Salson committed
487

488
## Main output files
489

490
The main output of Vidjil-algo (with the default `-c clones` command) are two following files:
491

492
  - The `.vidjil` file is *the file for the Vidjil web application*.
493
    The file is in a `.json` format (detailed in [vidjil-format](vidjil-format))
494 495 496 497
    describing the windows and their count, the consensus sequences (`-y`),
    the detailed V(D)J and CDR3 designation (`-z`, see warning below), and possibly
    the results of the further clustering.
    
498
    The web application takes this `.vidjil` file ([possibly merged with `fuse.py`](#following-clones-in-several-samples)) for the *visualization and analysis* of clones and their
499 500
    tracking along different samples (for example time points in a MRD
    setup or in a immunological study).
501
    Please see the [user manual](user.md) for more information on the web application.
502

503 504 505 506 507 508 509 510 511 512 513
  - The `.vdj.fa` file is *a FASTA file for further processing by other bioinformatics tools*.
    The sequences are at least the windows (and their count in the headers) or
    the consensus sequences (`-y`) when they have been computed.
    The headers include the count of each window, and further includes the
    detailed V(D)J and CDR3 designation (`-z`, see warning below), given in a '.vdj' format, see below.
    The further clustering is not output in this file.
    
    The `.vdj.fa` output enables to use Vidjil-algo as a *filtering tool*,
    shrinking a large read set into a manageable number of (pre-)clones
    that will be deeply analyzed and possibly further clustered by
    other software.
514

515
By default, the two output files are named `out/basename.vidjil` in `out/basename.vdj.fa`, where:
516

517 518
  - `out` is the directory where all the outputs are stored (can be changed with the `-o` option).
  - `basename` is the basename of the input `.fasta/.fastq` file (can be overriden with the `-b` option)
519

520
## Auxiliary output files
521

522
The `out/basename.windows.fa` file contains the list of windows, with number of occurrences:
523

524
``` diff
525
>8--window--1
526
TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
527
>5--window--2
528
CGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTAC
529 530
ATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGAC
(...)
531
```
532

533
Windows of size 50 (modifiable by `-w`) have been extracted.
534 535
The first window has 8 occurrences, the second window has 5 occurrences.

536
The `out/seq/clone.fa-*` contains the detailed analysis by clone, with
537
the window, the consensus sequence, as well as with the most similar V, (D) and J germline genes:
538

539
``` diff
540 541
>clone-001--IGH--0000008--0.0608%--window
TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
542
>clone-001--IGH--0000008--0.0608%--lcl|FLN1FA001CPAUQ.1|-[105,232]-#2 - 128 bp (55% of 232.0 bp) + VDJ  0 54 73 84 85 127   IGHV3-23*05 6/ACCCGGGAGGAACAATAT/9 IGHD6-13*01 0//5 IGHJ4*02  IGH SEG_+ 1.946653e-19 1.352882e-19/5.937712e-20
543 544 545 546 547 548 549 550 551 552
GCTGTACCTGCAAATGAACAGCCTGCGAGCCGAGGACACGGCCACCTATTACTGT
ACCCGGGAGGAACAATATAGCAGCTGGTAC
TTTGACTTCTGGGGCCAGGGGATCCTGGTCACCGTCTCCTCAG

>IGHV3-23*05
GAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTTATAGCAGTGGTAGTAGCACATACTATGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAA
>IGHD6-13*01
GGGTATAGCAGCAGCTGGTAC
>IGHJ4*02
ACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG
553
```
554

555 556
The `-a` debug option further output in each `out/seq/clone.fa-*` files the full list of reads belonging to this clone.
The `-a` option produces large files, and is not recommanded in general cases.
557

558
## Diversity measures
559

560
Several [diversity indices](https://en.wikipedia.org/wiki/Diversity_index) are reported, both on the standard output and in the `.vidjil` file:
561

562 563 564
  - H (`index_H_entropy`): Shannon's diversity
  - E (`index_E_equitability`): Shannon's equitability
  - Ds (`index_Ds_diversity`): Simpson's diversity
565

566
E ans Ds values are between 0 (no diversity, one clone clusters all analyzed reads)
567
and 1 (full diversity, each analyzed read belongs to a different clone).
568 569
These values are now computed on the windows, before any further clustering.
PCR and sequencing errors can thus lead to slighlty over-estimate the diversity.
570

571
## Unsegmentation causes
572

573
Vidjil-algo outputs details statistics on the reads that are not segmented (not analyzed).
574
Basically, **an unsegmented read is a read where Vidjil-algo cannot identify a window at the junction of V and J genes**.
575 576
To properly analyze a read, Vijdil needs that the sequence spans enough V region and J region
(or, more generally, 5' region and 3' regions when looking for incomplete or unusual recombinations).
577 578
The following unsegmentation causes are reported:

579 580 581 582 583 584 585 586 587 588 589 590 591 592
|                     |                                                                                                                          |
| ------------------- | ------------------------------------------------------------------------------------------------------------------------ |
| `UNSEG too short`   | Reads are too short, shorter than the seed (by default between 9 and 13 bp).                                             |
| `UNSEG strand`      | The strand is mixed in the read, with some similarities both with the `+` and the `-` strand.                            |
| `UNSEG too few V/J` | No information has been found on the read: There are not enough similarities neither with a V gene or a J gene.          |
| `UNSEG only V/5`    | Relevant similarities have been found with some V, but none or not enough with any J.                                    |
| `UNSEG only J/3`    | Relevant similarities have been found with some J, but none or not enough with any V.                                    |
| `UNSEG ambiguous`   | vidjil-algo finds some V and J similarities mixed together which makes the situation ambiguous and hardly solvable.      |
| `UNSEG too short w` | The junction can be identified but the read is too short so that vidjil-algo could extract the window (by default 50bp). |
|                     | It often means the junction is very close from one end of the read.                                                      |

Some datasets may give reads with many low `UNSEG too few` reads:

  - `UNSEG too few V/J` usually happens when reads share almost nothing with the V(D)J region.
593 594
    This is expected when the PCR or capture-based approach included other regions, such as in whole RNA-seq.

595
  - `UNSEG only V/5` and `UNSEG only J/3` happen when reads do not span enough the junction zone.
596
    Vidjil-algo detects a “window” including the CDR3. By default this window is 50bp long,
597 598
    so the read needs be that long centered on the junction.

599
See the [user manual](user.md) for information on the biological or sequencing causes that can lead to few segmented reads.
600

601
## Filtering reads
602

603 604 605 606 607 608 609 610 611 612
``` diff
Detailed output per read (generally not recommended, large files, but may be used for filtering, as in -uu -X 1000)
  -U                          output segmented reads (in .segmented.vdj.fa file)
  -u
        -u          output unsegmented reads, gathered by unsegmentation cause, except for very short and 'too few V/J' reads (in *.fa files)
        -uu         output unsegmented reads, gathered by unsegmentation cause, all reads (in *.fa files) (use only for debug)
        -uuu        output unsegmented reads, all reads, including a .unsegmented.vdj.fa file (use only for debug)
  -K                          output detailed k-mer affectation on all reads (in .affects file) (use only for debug, for example -KX 100)
```

613 614
It is possible to extract all segmented or unsegmented reads, possibly to give them to other software.
Runing Vidjil with `-U` gives a file `out/basename.segmented.vdj.fa`, with all segmented reads.
615
On datasets generated with rather specific V(D)J primers, this is generally not recommended, as it may generate a large file.
616
However, the `-U` option is very useful for whole RNA-Seq or capture datasets that contain few reads with V(D)J recombinations.
617

Mathieu Giraud's avatar
Mathieu Giraud committed
618 619
Similarly, options are available to get the unsegmented reads:

620 621 622 623 624 625
  - `-u` gives a set of files `out/basename.UNSEG_*`, with unsegmented reads gathered by unsegmentation cause.
    It outputs only reads sharing significantly sequences with V/J germline genes or with some ambiguity:
    it may be interesting to further study RNA-Seq datasets.

  - `-uu` gives the same set of files, including **all** unsegmented reads (including `UNSEG too short` and `UNSEG too few V/J`),
    and `-uuu` further outputs all these reads in a file `out/basename.unsegmented.vdj.fa`.
626 627 628

Again, as these options may generate large files, they are generally not recommended.
However, they are very useful in some situations, especially to understand why some dataset gives poor segmentation result.
629
For example `-uu -X 1000` splits the unsegmented reads from the 1000 first reads.
Mikaël Salson's avatar
Mikaël Salson committed
630

631 632 633

## AIRR .tsv output

634 635
**(draft version)**

636
Since version 2018.10, vidjil-algo supports the [AIRR format](http://docs.airr-community.org/en/latest/datarep/rearrangements.html#fields).
637
We export all required fields, some optional fields, as also some custom fields (+).
638 639

Note that Vidjil-algo is designed to efficiently gather reads into clones. We thus report in the AIRR format *clones*.
640 641
See also [What is a clone ?](vidjil-format/#what-is-a-clone).

642 643 644 645


| Name  | Type | AIRR 1.2 Description <br /> *vidjil-algo implementation* |
| ----- | ---- |  ------------------------------------------------------- |
646 647
| locus | string | Gene locus (chain type). For example, `IGH`, `IGK`, `IGL`, `TRA`, `TRB`, `TRD`, or `TRG`.<br />*Vidjil-algo outputs all these loci. Moreover, the incomplete recombinations analyzed by vidjil-algo are reported as `IGH+`, `IGK+`, `TRA+D`, `TRB+`, `TRD+`, and `xxx` for unexpected recombinations. See  [locus](locus).*
| consensus_count | number | Number of reads contributing to the (UMI) consensus for this sequence. For example, the sum of the number of reads for all UMIs that contribute to the query sequence. <br />*Number of reads gathered in the clone.*
648 649
| sequence_id | string  | Unique query sequence identifier within the file. Most often this will be the input sequence header or a substring thereof, but may also be a custom identifier defined by the tool in cases where query sequences have been combined in some fashion prior to alignment. <br />*This identifier is the (50 bp by default) window extacted around the junction.* |
| clone_id 	| string | 	Clonal cluster assignment for the query sequence. <br />*This identifier is again the (50 bp by default) window extacted around the junction.*
650
| warnings (+) | string | *Warnings associated to this clone. See <https://gitlab.vidjil.org/blob/dev/doc/warnings.md>.*
651 652
| sequence  | string | The query nucleotide sequence. Usually, this is the unmodified input sequence, which may be reverse complemented if necessary. In some cases, this field may contain consensus sequences or other types of collapsed input sequences if these steps are performed prior to alignment. <br />*This contains the consensus/representative sequence of each clone.*
| rev_comp  | boolean | True if the alignment is on the opposite strand (reverse complemented) with respect to the query sequence. If True then all output data, such as alignment coordinates and sequences, are based on the reverse complement of 'sequence'. <br />*Set to null, as vidjil-algo gather reads from both strands in clones* |
653
| v_call, d_call, j_call  | string  | V/D/J gene with allele. For example, IGHV4-59\*01. <br /> *implemented. In the case of uncomplete/unexpected recombinations (locus with a `+`), we still use `v/d/j_call`. Note that this value can be null on clones beyond the `-z` option.* |
654 655 656
| junction  | string  |      Junction region nucleotide sequence, where the junction is defined as the CDR3 plus the two flanking conserved codons. <br />*null*
| junction_aa  | string  | Junction region amino acid sequence.      <br />*implemented*
| cdr3_aa | string | Amino acid translation of the cdr3 field.   <br />*implemented*
657
| productive | boolean | True if the V(D)J sequence is predicted to be productive.  <br /> *true, false, or null when no CDR3 has been detected* |
658 659
| sequence_alignment  | string  | Aligned portion of query sequence, including any indel corrections or numbering spacers, such as IMGT-gaps. Typically, this will include only the V(D)J region, but that is not a requirement. <br /> *null*                                         |
| germline_alignment | string  | Assembled, aligned, fully length inferred germline sequence spanning the same region as the sequence_alignment field (typically the V(D)J region) and including the same set of corrections and spacers (if any). <br />*null*
660
| v_cigar, d_cigar, j_cigar | string  | CIGAR strings for the V/D/J gene <br />*null*.
661

662 663 664
Currently, we do not output alignment strings.
Our implementation of .tsv may evolve in future versions.
Contact us if a particular feature does interest you.
665 666


667
## Segmentation and .vdj format
668

669
Vidjil output includes segmentation of V(D)J recombinations. This happens
670 671
in the following situations:

672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694
  - in a first pass, when requested with `-U` option, in a `.segmented.vdj.fa` file.
    
    The goal of this ultra-fast segmentation, based on a seed
    heuristics, is only to identify the locus and to locate the w-window overlapping the
    CDR3. This should not be taken as a real V(D)J designation, as
    the center of the window may be shifted up to 15 bases from the
    actual center.

  - in a second pass, on the standard output and in both `.vidjil` and `.vdj.fa` files
    
      - at the end of the clones detection (default command `-c clones`,
        on a number of clones limited by the `-z` option)
      - or directly when explicitly requiring segmentation (`-c segment`)
    
    These V(D)J designations are obtained by full comparison (dynamic programming)
    with all germline sequences.
    
    Note that these designations are relatively slow to compute, especially
    for the IGH locus. However, they
    are not at the core of the Vidjil clone clustering method (which
    relies only on the 'window', see above).
    To check the quality of these designations, the automated test suite include
    sequences with manually curated V(D)J designations (see [should-vdj.org](http://git.vidjil.org/blob/master/doc/should-vdj.org)).
Mikaël Salson's avatar
Mikaël Salson committed
695 696

Segmentations of V(D)J recombinations are displayed using a dedicated
697 698
`.vdj` format. This format is compatible with FASTA format. A line starting
with a \> is of the following form:
Mikaël Salson's avatar
Mikaël Salson committed
699

700
``` diff
701
>name + VDJ  startV endV   startD endD   startJ  endJ   Vgene   delV/N1/delD5'   Dgene   delD3'/N2/delJ   Jgene   comments
Mikaël Salson's avatar
Mikaël Salson committed
702

703
        name          sequence name (include the number of occurrences in the read set and possibly other information)
Mikaël Salson's avatar
Mikaël Salson committed
704
        +             strand on which the sequence is mapped
705
        VDJ           type of segmentation (can be "VJ", "VDJ", "VDDJ", "53"...
706 707
                      or shorter tags such as "V" for incomplete sequences).    
              The following line are for "VDJ" recombinations :
Mikaël Salson's avatar
Mikaël Salson committed
708

709
        startV endV   start and end position of the V gene in the sequence (start at 1)
Mikaël Salson's avatar
Mikaël Salson committed
710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725
        startD endD                      ... of the D gene ...
        startJ endJ                      ... of the J gene ...

        Vgene         name of the V gene 

        delV          number of deletions at the end (3') of the V
        N1            nucleotide sequence inserted between the V and the D
        delD5'        number of deletions at the start (5') of the D

        Dgene         name of the D gene being rearranged

        delD3'        number of deletions at the end (3') of the D
        N2            nucleotide sequence inserted between the D and the J
        delJ          number of deletions at the start (5') of the J

        Jgene         name of the J gene being rearranged
726

727
        comments      optional comments. In Vidjil, the following comments are now used:
728
                      - "seed" when this comes for the first pass (.segmented.vdj.fa). See the warning above.
729
                      - "!ov x" when there is an overlap of x bases between last V seed and first J seed
730 731
                      - the name of the locus (TRA, TRB, TRG, TRD, IGH, IGL, IGK, possibly followed
                        by a + for incomplete/unusual recombinations)
Mikaël Salson's avatar
Mikaël Salson committed
732

733
```
Mikaël Salson's avatar
Mikaël Salson committed
734

Mikaël Salson's avatar
Mikaël Salson committed
735 736 737 738 739
Following such a line, the nucleotide sequence may be given, giving in
this case a valid FASTA file.

For VJ recombinations the output is similar, the fields that are not
applicable being removed:
Mikaël Salson's avatar
Mikaël Salson committed
740

741
``` diff
742
>name + VJ  startV endV   startJ endJ   Vgene   delV/N1/delJ   Jgene  comments
743
```
744

745
# Examples of use
746

747 748
Examples on a IGH VDJ recombinations require either to specigy `-g germline/homo-sapiens-g:IGH`,
or to use the multi-germline option `-g germline/homo-sapiens.g` that can be shortened into `-g germline`.
749

750
## Basic usage: PCR-based datasets, with primers in the V(D)J regions (such as BIOMED-2 primers)
751

752
``` bash
753 754 755 756 757
./vidjil-algo -c clones   -g germline/homo-sapiens.g -2 -3 -r 1  demo/Demo-X5.fa
  # Detect the locus for each read, cluster and report clones starting from the first read (-r 1).
  # including unexpected recombinations (-2). Assign the V(D)J genes and try to detect the CDR3s (-3).
  # Demo-X5 is a collection of sequences on all human locus, including some incomplete or unusual recombinations:
  # IGH (VDJ, DJ), IGK (VJ, V-KDE, Intron-KDE), IGL, TRA, TRB (VJ, DJ), TRG and TRD (VDDJ, Dd2-Dd3, Vd-Ja).
758
```
759

760
``` bash
761
./vidjil-algo -g germline/homo-sapiens.g:IGH -3 demo/Stanford_S22.fasta
762 763
   # Cluster the reads and report the clones, based on windows overlapping IGH CDR3s.
   # Assign the V(D)J genes and try to detect the CDR3 of each clone.
764
   # Summary of clones is available both on stdout, in out/Stanford_S22.vdj.fa and in out/Stanford_S22.vidjil.
765
```
766

767
``` bash
768
./vidjil-algo -g germline -2 -3 -d demo/Stanford_S22.fasta
769
   # Detects for each read the best locus, including an analysis of incomplete/unusual and unexpected recombinations
770
   # Cluster the reads into clones, again based on windows overlapping the detected CDR3s.
771
   # Assign the VDJ genes (including multiple D) and try to detect the CDR3 of each clone.
772
   # Summary of clones is available both on stdout, in out/reads.vdj.fa and in out/reads.vidjil.
773
```
774

775
## Basic usage: Whole RNA-Seq or capture datasets
776

777
``` bash
778
./vidjil-algo -g germline -2 -U demo/Stanford_S22.fasta
779
   # Detects for each read the best locus, including an analysis of incomplete/unusual and unexpected recombinations
780
   # Cluster the reads into clones, again based on windows overlapping the detected CDR3s.
781
   # Assign the VDJ genes and try to detect the CDR3 of each clone.
782
   # The out/reads.segmented.vdj.fa include all reads where a V(D)J recombination was found
783
```
784

785
Typical whole RNA-Seq or capture datasets may be huge (several GB) but with only a (very) small portion of CDR3s.
786 787
Using Vidjil with `-U` will create a `out/reads.segmented.vdj.fa` file
that includes all reads where a V(D)J recombination (or an unexpected recombination, with `-2`) was found.
788 789
This file will be relatively small (a few kB or MB) and can be taken again as an input for Vidjil or for other programs.

790
## Advanced usage
791

792
``` bash
793
./vidjil-algo -c clones -g germline/homo-sapiens.g -r 1 -n 5 -x 10000 demo/LIL-L4.fastq.gz
794
   # Extracts the windows with at least 1 read each (-r 1, the default being -r 5)
795 796 797 798
   # on the first 10,000 reads, then cluster them into clones
   # with a second clustering step at distance five (-n 5)
   # The result of this second is in the .vidjil file ('clusters')
   # and can been seen and edited in the web application.
799
```
800

801
``` bash
802
./vidjil-algo -c segment -g germline/homo-sapiens.g -2 -3 -d -x 50 demo/Stanford_S22.fasta
803
   # Detailed V(D)J designation, including multiple D, and CDR3 detection on the first 50 reads, without clone clustering
804
   # (this is slow and should only be used for testing, or on a small file)
805
```
806

807
``` bash
808
./vidjil-algo -c germlines -g germline/homo-sapiens.g demo/Stanford_S22.fasta
809
   # Output statistics on the number of occurrences of k-mers of the different germlines
810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838
```

## Following clones in several samples

In a minimal residual disease setup, for instance, we are interested in
following the main clones identified at diagnosis in the following samples.

In its output files, Vidjil keeps track of all the clones, even if it
provides a V(D)J assignation only for the main ones. Therefore the
meaningful information is already in the files (for instance in the `.vidjil`
files). However we have one `.vidjil` per sample which may not be very
convenient. All the more since the web client only takes one `.vidjil` file
as input and cannot take several ones.

Therefore we need to merge all the `.vidjil` files into a single one. That is
the purpose of the [tools/fuse.py](../tools/fuse.py) script.

Let assume that four `.vidjil` files have been produced for each sample
(namely `diag.vidjil`, `fu1.vidjil`, `fu2.vidjil`, `fu3.vidjil`), merging them will
be done in the following way:

``` bash
python tools/fuse.py --output mrd.vidjil --top 100 diag.vidjil fu1.vidjil fu2.vidjil fu3.vidjil
```

The `--top` parameter allows to choose how many top clones per sample should
be kept. 100 means that for each sample, the top 100 clones are kept and
followed in the other samples. In this example the output file is stored in
`mrd.vidjil` which can then be fed to the web client.