vquest_imgt.html 7.71 KB
Newer Older
Francois Dubiez's avatar
Francois Dubiez committed
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61
<!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.0//EN">
<!-- saved from url=(0038)http://www.imgt.org/IMGT_vquest/vquest -->
<html><head><meta http-equiv="Content-Type" content="text/html; charset=windows-1252"><title>IMGT/V-QUEST</title>

<link type="text/css" href="./vquest_files/VQUEST.css" rel="stylesheet">
<link type="text/css" href="./vquest_files/styleFoot.css" rel="stylesheet">
</head>
<body bgcolor="#FFFFFF">
<table cols="2" width="100%">
<tbody><tr>
<td align="LEFT" nowrap="" valign="middle" width="70%">
<font size="+3" color="#000099"><b>THANK YOU</b><br>
<b> for using
<a href="http://www.imgt.org/IMGT_vquest/share/textes/imgtvquest.html">
IMGT/V-QUEST</a></b>
</font><br>
<p>
<font color="#000099">THE<br>
INTERNATIONAL<br>
IMMUNOGENETICS<br>
INFORMATION SYSTEM</font></p></td>
<td align="RIGHT" valign="TOP" width="30%">
<img src="./vquest_files/logoIMGT.png" alt="WELCOME !"><p>
<font size="+1" color="#000099">
http://www.imgt.org</font>
</p></td>
</tr>
</tbody></table>
<p>

<!-- VQUEST/l02p01.html -->
</p><hr>
<pre>Date	Sun Nov 08 18:24:53 CET 2015	
IMGT/V-QUEST program version	3.3.5	
IMGT/V-QUEST reference directory release	201544-3	
Species	Homo sapiens	
Receptor type or locus	TR	
IMGT directory reference set	F+ORF+ in-frame P	

Search for insertions and deletions	yes	



CSV file: 2_IMGT-gapped-nt-sequences

Sequence number	Sequence ID	Functionality	V-GENE and allele	J-GENE and allele	D-GENE and allele	V-D-J-REGION	V-J-REGION	V-REGION	FR1-IMGT	CDR1-IMGT	FR2-IMGT	CDR2-IMGT	FR3-IMGT	CDR3-IMGT	JUNCTION	J-REGION	FR4-IMGT	
1	TRGV3*01_-13/4/-9_TRGJ1*02	unproductive	Homsap TRGV3*01 F	Homsap TRGJ1*01 F, or Homsap TRGJ1*02 F or Homsap TRGJ2*01 F			...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgcggcggaaactctttggcagtggaacaacac	...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgc	..............................................................................	....................................	.........................ggaaggccccacagcgtcttctgtac	tatgacgtctcc......accgcaagggat	gtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgt	gcggcggaaactc	tgtgcggcggaaactcttt	gaaactctttggcagtggaacaacac	tttggcagtggaacaacac	
2	TRGV3*01_-0/2/-0_TRGJ1*02	productive	Homsap TRGV3*01 F	Homsap TRGJ1*02 F			...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgccacctgggacaggtgttattataagaaactctttggcagtggaacaacac	...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgccacctgggacagg	..............................................................................	....................................	.........................ggaaggccccacagcgtcttctgtac	tatgacgtctcc......accgcaagggat	gtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgt	gccacctgggacaggtgttattataagaaactc	tgtgccacctgggacaggtgttattataagaaactcttt	ttattataagaaactctttggcagtggaacaacac	tttggcagtggaacaacac	
3	TRGV3*01_-1/4/-0_TRGJ1*02	unproductive	Homsap TRGV3*01 F	Homsap TRGJ1*02 F			...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgccacctgggacagcgctttattataagaaactctttggcagtggaacaacac	...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgccacctgggacag	..............................................................................	....................................	.........................ggaaggccccacagcgtcttctgtac	tatgacgtctcc......accgcaagggat	gtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgt	gccacctgggacagcgctttattataagaaactc	tgtgccacctgggacagcgctttattataagaaactcttt	ttattataagaaactctttggcagtggaacaacac	tttggcagtggaacaacac	
4	TRGV3*01_-0/9/-5_TRGJ1*02	unproductive	Homsap TRGV3*01 F	Homsap TRGJ1*02 F			...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgccacctgggacaggctcaagggaataagaaactctttggcagtggaacaacac	...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgccacctgggacagg	..............................................................................	....................................	.........................ggaaggccccacagcgtcttctgtac	tatgacgtctcc......accgcaagggat	gtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgt	gccacctgggacaggctcaagggaataagaaactc	tgtgccacctgggacaggctcaagggaataagaaactcttt	ataagaaactctttggcagtggaacaacac	tttggcagtggaacaacac	
5	TRGV3*01_-2/5/-2_TRGJ1*01	unproductive	Homsap TRGV3*01 F	Homsap TRGJ1*01 F, or Homsap TRGJ2*01 F			...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgccacctgggacatggggattattataagaaactctttggcagtggaacaacac	...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgccacctgggaca	..............................................................................	....................................	.........................ggaaggccccacagcgtcttctgtac	tatgacgtctcc......accgcaagggat	gtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgt	gccacctgggacatggggattattataagaaactc	tgtgccacctgggacatggggattattataagaaactcttt	attattataagaaactctttggcagtggaacaacac	tttggcagtggaacaacac	
</pre>

<hr><p>
<a href="http://www.imgt.org/IMGT_vquest/share/textes/imgtvquest.html">-&gt; IMGT/V-QUEST Documentation</a><br>
<a href="http://www.imgt.org/IMGT_vquest/share/textes/">-&gt; IMGT/V-QUEST Search page</a>
</p><p>



</p></body></html>