should-vdj.org 6.59 KB
Newer Older
1 2
#+TITLE: should-vdj.fa -- Sequences with manually curated V(D)J designations
#+AUTHOR: The Vidjil team
3
#+HTML_HEAD: <link rel="stylesheet" type="text/css" href="org-mode.css" />
4 5 6 7 8 9
# contact@vidjil.org


* A quality control of bioinformatics analysis

The =.should-vdj.fa= tests are sequences with manually curated V(D)J designations.
10
These designations were checked by hand, possibly with the help of some bioinformatics tools.
11 12 13
Tests may range from very easy cases with unambiguous V(D)J designations
to borderline or difficult cases, including incomplete or unusual recombinations or translocations.

14 15
This collection of sequences, distributed as open-source data, may help the robustness
of any software doing immune repertoire sequencing (RepSeq) analysis.
16 17 18 19


* Contributing to the tests

20
Users and developers of RepSeq software are encouraged to send us (=contact@vidjil.org=)
21 22 23
their manually curated sequences, ideally in the format described below, or by
directly proposing pull requests on GitHub with new tests in the [[https://github.com/vidjil/vidjil/tree/master/algo/tests/should-vdj-tests][=algo/tests/should-vdj=]] directory.
We can also help to encode sequences in this format.
24
The current tests were contributed by:
25
 - Yann Ferret (CHRU Lille), 2014-2015 [1]
26
 - Florian Thonier (Inserm, Paris Necker), 2015
27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105

* A =.should-vdj.fa= file

A =.should-vdj.fa= file is (almost) a Fasta file, containing one or several sequences
with their V(D)J designation:

#+BEGIN_EXAMPLE
>IGKV1-5*03 9/4/1 IGKJ1*01  [IGK]
TATTAATAACAACTTGGCCTGGTATCAGGAGAAGCCAGGGAAAGCCCCTAAGGTCCTG
ATCTATAAGGCGTCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGAT
CTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACCTA
TTACTGCCAACAATATAATAGACTTTGGACGTTCGGCCAAGGGACCAAGGTGGAAGTC
AAACGAACTGTGGCTGCACCATCT

# Patient 0122
>TRGV5*01 4/AG/5 TRGJP2*01  [TRG]   # 1st clone
GGAAGGCCCCACAGCGTCTTCTGTACTATGACGTCTCCAACTCAAAGGATGTGTTGGAA
TCAGGACTCAGTCCAGGAAAGTATTATACTCATACACCCAGGAGGTGGAGCTGGATATT
GATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGA
ag
AGTGATTGGATCAAGACGTTTGCAAAAGGGACTAGGCTCATAGTAACTTCGCCTGGTAA

>TRGV11 TRGJ1  [TRG]               # 2nd clone
TCTTCCACTTCCACTTtgAAAATAAAGTTCTTAGAGAAAGAAGATGAGGTGGTGTACC
aCTGTGCCTGCtaGTCACCTCATCGAATTATTATAAGA
#+END_EXAMPLE

Nucleotide sequences can mix upper-case and lower-case characters, and may contain arbitrary line breaks.
Comments can be given either as lines starting with =#=, or parts of headers, again starting with =#=.


* Encoding the V(D)J designation

The header of each sequence, beginning by =>=, gives the V(D)J designation of the underlying sequence,
such as in =>IGKV1-5*03 9/CTAC/1 IGKJ1*01  [IGK]=.


- Gene names are taken as specified in IMGT/GENE-DB.
  They can be either fully qualified, with their alleles (=IGKJ1*01=) or without (=IGKJ1=).
  When there is no allele given, the number of deletions for the N regions should refer to the =*01= allele.
  Special names are also accepted, such as =Intron= or =KDE=.

- N-regions are given in three components: number of nucleotides deleted at the right (3') of the left segment,
  insertion, and number of nucleotides deleted at the left (5') of the right segment.
  The insertion can be specified either by the full sequence of nucleotides (=9/CCCTGG/1=),
  or by only the number of nucleotides (=9/6/1=).

- N-regions are optional : =>IGKV1-5*03 IGKJ1*01= can be given instead of =>IGKV1-5*03 9/4/1 IGKJ1*01=

The designation can thus be very short, such as in =>TRGV2 TRGJP1=.
However, it is advised to put as much information as possible in the designation,
such as in =>TRGV2*01 9/CCCTGG/1 TRGJP1*01  [TRG]=.
Such complete designations will give more extensive tests.

VDJ recombinations can be encoded, such as
- =>IGHV3-74*02 7/CCGCGGT/6 IGHD3-9*01 4/CTTCGAACA/7 IGHJ4*02=

Incomplete or unusual recombinations can also be specified, such as
- =>IGHD7-27*01 10/CATTA/0 IGHJ3*02=
- =>TRDV1*01 TRDD2*01 TRAJ29*01=
- =>TRDD2 18/6/0 TRDD3 5/5/0 TRDJ1=
- =>Intron 2/0/9 KDE=

Very special cases should be explained by comments in plain English.


* Encoding the locus

The end of the header may also contain information on the locus, between brackets, leading to additional tests.
This also allows to specify only =>[TRG]= for a sequence that should be recognized as TRG
even if it is difficult to choose a precise VJ designation.

Human locus should be encoded by =[IGH]=, =[IGK]=, =[IGL]=, =[TRA]=, =[TRB]=, =[TRG]=, =[TRD]=.
Incomplete or unusual recombinations can be encoded with an additional =+= character, such as in =[IGH+]= or =[TRD+]=.
Mixed TRA/TRD recombinations can be encoded with =[TRA+D]=.

Other special cases, such as translocations involving BCL1 or BCL2, should be written now as comments after a =#= character.


106 107 108 109 110 111 112 113 114
* Encoding the JUNCTION/CDR3 information

JUNCTION or CDR3 information can be optionnaly encoded, using curly braces:

#+BEGIN_EXAMPLE
>TRGV10*02 5/AGAC/3 TRGJP1*01  [TRG]  {CAAWRPTGWFKIF}
AAGTCCGTAGAGAAAGAAGACATGGCCGTTTACTACTGTGCTGCGTGGAGACCCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGC
#+END_EXAMPLE

115
* Ambiguous or alternate designations
116 117

On some sequences, several V(D)J designations may be equally acceptable.
118 119
These alternate choices can be encoded as =(choice1, choice2)=.
For difficult cases, is advised to further leave a comment in plain English:
120 121

#+BEGIN_EXAMPLE
122
# The D/J junction can be seen as 2//7, 3//6, or 4//5
123
>IGHV3-48*01 0/AA/6 IGHD5-12*01 (2//7, 3//6, 4//5) IGHJ4*02  [IGH]
124 125 126 127 128
ATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGAAAATAGTG
GCTACGATTTGACTAC
TGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGTT

# TRGJ1*01 or TRGJ1*02
129
>TRGV5*01 (TRGJ1*01, TRGJ1*02)  [TRG]
130
...
131 132 133

# TRGJ1*01 or TRGJ1*02 but with different deletions
>TRGV4*02 (4/4/4 TRGJ1*01, 4/4/1 TRGJ1*02) [TRG]
134 135 136
#+END_EXAMPLE


137 138


139 140 141 142 143 144 145 146
* Program-specific information

** Vidjil

In Vidjil, the automated test suite launches the analysis on all these
sequences and compares the computed designations with the curated designations.
Cases with current failure will be marked as TODO.
Having a correct behavior on these tests may be a goal for future releases.
147

148
Vidjil can be tested on =.should-vdj:= tests can be launched within the =algo/tests= directory:
149 150 151 152
  - =python should-vdj-to-tap.py= runs one or several tests, given as parameters on the command line,
  - =make shouldvdj= runs all =.should-vdj.fa= tests,
  - =make shouldvdj_and_locus= further runs tests on the locus.
    This locus test is also launched for all reverse complement sequences.
153 154 155 156 157 158 159 160 161


* References

The paper [1] includes an evaluation of the V(D)J designation of 125 clones.

[1] Y. Ferret, A. Caillault and al.,
    Multi-loci diagnosis of acute lymphoblastic leukaemia with high-throughput sequencing and bioinformatics analysis
    British Journal of Haematology, doi:10.1111/bjh.13981, 2016, in press.