diff --git a/browser/js/clone.js b/browser/js/clone.js
index e54ce82a78c3bc122830c218823022c5e0a2df7a..aba792994abd1dc2ac8220e785568ad9e274520a 100644
--- a/browser/js/clone.js
+++ b/browser/js/clone.js
@@ -234,6 +234,7 @@ Clone.prototype = {
 
     /**
      * Compute feature positions (start/stop) from its sequence, unless they are already present
+     * Computed positions are converted to start from 0 and can be used without manipualtions
      */
     computeSegFeatureFromSeq: function(field_name)
     {
@@ -251,8 +252,8 @@ Clone.prototype = {
             // No feature here
             return;
 
-        this.seg[field_name].start = pos + 1
-        this.seg[field_name].stop = pos + seq.length
+        this.seg[field_name].start = pos
+        this.seg[field_name].stop  = pos + seq.length -1
     },
 
 
@@ -273,7 +274,7 @@ Clone.prototype = {
     getSegNtSequence: function(field_name) {
         positions = this.getSegStartStop(field_name)
         if (positions !== null) {
-            return this.sequence.substr(positions.start-1, positions.stop - positions.start+1)
+            return this.sequence.substr(positions.start, positions.stop - positions.start+1)
         }
         return '';
     },
@@ -311,6 +312,7 @@ Clone.prototype = {
 
     /**
      * Get the start and stop position of a given field (e.g. cdr3)
+     * Getted positions are 0 based.
      * If it does not exist return null
      */
     getSegStartStop: function(field_name) {
diff --git a/browser/test/QUnit/testFiles/clone_test.js b/browser/test/QUnit/testFiles/clone_test.js
index 7f18a98ee940a4a81db7308cac04d4e7efb7f55e..345b1f911d020211c28cc8c697e8bcd835e8939e 100644
--- a/browser/test/QUnit/testFiles/clone_test.js
+++ b/browser/test/QUnit/testFiles/clone_test.js
@@ -15,7 +15,7 @@ QUnit.module("Clone", {
             "3start" : 15,
             "5" : {'start': 1, 'end': 5}, // 0-based (old format, with 'end')
             "cdr3": {
-                "start": 11,
+                "start": 8,
                 "stop": 16,
                 "aa": "ABCDE"
             },
@@ -248,10 +248,10 @@ QUnit.test("name, informations, getHtmlInfo", function(assert) {
         "getHtmlInfo: segmentation information (V gene) after changment");
 
     // Test junction in html export
-    assert.includes(html, "<tr><td>junction</td><td colspan='4'>aat</td></tr>",
+    assert.includes(html, "<tr><td>junction</td><td colspan='4'>att</td></tr>",
                  "getHtmlInfo c1: junction info for productive clone");   
     html = c3.getHtmlInfo();
-    assert.includes(html, "<tr><td>junction</td><td colspan='4'>aaaaaaaaattt</td></tr>",
+    assert.includes(html, "<tr><td>junction</td><td colspan='4'>aaaaaaaatttt</td></tr>",
                  "getHtmlInfo c3: junction info for non productive clone");   
     assert.includes(html, "<tr><td>junction (AA seq)</td><td colspan='4'>WKIC</td></tr>",
                  "getHtmlInfo c3: junction (AAseq) info for non productive clone"); 
@@ -272,10 +272,10 @@ QUnit.test('clone: get info from seg', function(assert) {
     assert.notOk(c1.hasSeg('toto'), "clone1 doesn't have toto")
     assert.notOk(c1.hasSeg('junction', 'toto'), "clone1 has junction but doesn't have toto")
 
-    assert.equal(c1.getSegLength('cdr3'), 6, "CDR3 length");
+    assert.equal(c1.getSegLength('cdr3'), 9, "CDR3 length");
     assert.equal(c2.getSegLength('cdr3'), 'undefined', "no cdr3 in c2");
     var pos_cdr3 = c1.getSegStartStop('cdr3')
-    assert.equal(pos_cdr3['start'], 10, "CDR3 length")
+    assert.equal(pos_cdr3['start'], 7, "CDR3 length")
     assert.equal(pos_cdr3['stop'], 15, "CDR3 length")
     assert.equal(c1.getSegStartStop('toto'), null, "no toto record")
     var pos_junction = c3.getSegStartStop('junction')
@@ -292,7 +292,8 @@ QUnit.test('clone: get info from seg', function(assert) {
     c1.computeEValue()
     assert.equal(c1.eValue, 1e-2, 'Recomputing e-value should not change its value')
 
-    assert.equal(c1.getSegNtSequence('junction'), 'aat', 'junction c1')
+    assert.equal(c1.getSegNtSequence('junction'), 'att', 'junction c1')
+    assert.equal(c1.getSegNtSequence('cdr3'), 'aaatttttt', 'sequence cdr3 c1 (by getSegNtSequence)')
     assert.equal(c1.getSegAASequence('junction'), '', 'no AA junction for c1')
     assert.equal(c1.getSegAASequence('cdr3'), 'ABCDE', 'AA CDR3 for c1')
 
@@ -310,7 +311,7 @@ QUnit.test("clone : feature defined by a nucleotide sequence", function(assert)
 
     assert.deepEqual(c3.getSegStartStop('somefeature'), null, "start/stop positions are not present")
     c3.computeSegFeatureFromSeq('somefeature')
-    assert.deepEqual(c3.getSegStartStop('somefeature'), {"start": 7, "stop": 13}, "start/stop positions, computed from sequence")
+    assert.deepEqual(c3.getSegStartStop('somefeature'), {"start": 6, "stop": 12}, "start/stop positions, computed from sequence")
     assert.equal(c3.getSegLength('somefeature'), 7, "length of the feature");
 });
 
@@ -439,7 +440,7 @@ QUnit.test("export", function(assert) {
         "TRG", "-/-",
         "undefined V", "IGHD2*03", "IGHV4*01",
         "not productive",
-        "aaaaaaaaattt",
+        "aaaaaaaatttt",
         "WKIC",
         "AAAAAAAAAATTTTTTTTT",
         10, 10, 15, 15,
diff --git a/browser/test/QUnit/testFiles/model_test.js b/browser/test/QUnit/testFiles/model_test.js
index dc2fc8824fe06dee3b0357080e93afcc2124922e..6b9f4b743eb1b8292b817b52d94935083321ceaa 100644
--- a/browser/test/QUnit/testFiles/model_test.js
+++ b/browser/test/QUnit/testFiles/model_test.js
@@ -349,8 +349,8 @@ QUnit.test("model: primer detection", function(assert) {
     // primer found inside clones
     assert.equal(typeof m.clones[2]["seg"]["primer5"], "undefined", "Control neg primer 5 not in sequence")
     assert.equal(typeof m.clones[2]["seg"]["primer3"], "undefined", "Control neg primer 3 not in sequence")
-    assert.deepEqual(m.clones[3]["seg"]["primer5"], { seq: "GGAAGGCCCCACAGCG", start: 1, stop: 16 },    "Found primer 5")
-    assert.deepEqual(m.clones[3]["seg"]["primer3"], { seq: "AACTTCGCCTGGTAA",  start: 227, stop: 241 }, "Found primer 3")
+    assert.deepEqual(m.clones[3]["seg"]["primer5"], { seq: "GGAAGGCCCCACAGCG", start: 0, stop: 15 },    "Found primer 5")
+    assert.deepEqual(m.clones[3]["seg"]["primer3"], { seq: "AACTTCGCCTGGTAA",  start: 226, stop: 240 }, "Found primer 3")
 
 
     m.cleanPreviousFeature("primer3")
diff --git a/browser/test/QUnit/testFiles/segmenter_test.js b/browser/test/QUnit/testFiles/segmenter_test.js
index 812a65ab5019309c300b252c7ad7fac41723c375..3a450d1190587acb180a8d01ca820dd977586755 100644
--- a/browser/test/QUnit/testFiles/segmenter_test.js
+++ b/browser/test/QUnit/testFiles/segmenter_test.js
@@ -111,8 +111,8 @@ QUnit.test("sequence", function(assert) {
     assert.equal(h.stop, 6, '"f1" feature, stop')
 
     h = seq1.get_positionned_highlight('f2', '')
-    assert.equal(h.start, 15, '"f2" feature, start')
-    assert.equal(h.stop, 20, '"f2" feature, stop')
+    assert.equal(h.start, 14, '"f2" feature, start')
+    assert.equal(h.stop, 19, '"f2" feature, stop')
 
     segment.updateElemStyle([4]) /* Will remove sequence 4 from the segmenter
                                   * as it is not really selected
@@ -138,11 +138,11 @@ QUnit.test("segt", function (assert) {
     assert.equal(m.clone(3).getSequence(),"GGAAGGCCCCACAGCGTCTTCTGTACTATGACGTCTCCACCGCAAGGGATGTGTTGGAATCAGGACTCAGTCCAGGAAAGTATTATACTCATACACCCAGGAGGTGGAGCTGGATATTGAGACTGCAAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGACAGGCTGAAGGATTGGATCAAGACGTTTGCAAAAGGGACTAGGCTCATAGTAACTTCGCCTGGTAA","sequence")
     m.clone(3).addSegFeatureFromSeq('test_feature','CACCCAGGAGGTGGAGCTGGATATTGAGACT');
     f1 = segment.sequence[3].get_positionned_highlight('test_feature','');
-    assert.equal(f1.start, 94 , "feature start");
-    assert.equal(f1.stop, 124, "feature stop");
+    assert.equal(f1.start, 93 , "feature start");
+    assert.equal(f1.stop, 123, "feature stop");
     assert.equal(f1.seq,'CACCCAGGAGGTGGAGCTGGATATTGAGACT', "feature sequence");
     assert.equal(m.clone(3).getSegNtSequence("test_feature"), "CACCCAGGAGGTGGAGCTGGATATTGAGACT", "feature sequence 3");
-    assert.deepEqual(m.clone(3).getSegFeature("test_feature"),{"seq": "CACCCAGGAGGTGGAGCTGGATATTGAGACT", "start": 94, "stop": 124}, "feature sequence 4");
+    assert.deepEqual(m.clone(3).getSegFeature("test_feature"),{"seq": "CACCCAGGAGGTGGAGCTGGATATTGAGACT", "start": 93, "stop": 123}, "feature sequence 4");
     
     // segment.sequence[3].computeAAseq()
     // assert.equal(m.clone(3).getSegAASequence("cdr3"),"AKDILKSLKQQLATPNWFDP","feature sequence 2")
@@ -156,7 +156,7 @@ QUnit.test("segt", function (assert) {
     var h = segment.sequence[3].get_positionned_highlight('f1','');
     assert.equal(h.start,-1, " start feature value");
     assert.equal(h.stop, -1, "stop feature value");
-    assert.deepEqual(segment.sequence[3].get_positionned_highlight("test_feature",""),{"color": "", "css": "highlight_seq", "seq": "CACCCAGGAGGTGGAGCTGGATATTGAGACT", "start": 94, "stop": 124, "tooltip": ""}, "test feature value")
+    assert.deepEqual(segment.sequence[3].get_positionned_highlight("test_feature",""),{"color": "", "css": "highlight_seq", "seq": "CACCCAGGAGGTGGAGCTGGATATTGAGACT", "start": 93, "stop": 123, "tooltip": ""}, "test feature value")
     assert.equal(m.clone(3).getSegLength('test_feature'),31, "feature length");
     m.unselectAll();
     assert.equal(segment.toFasta(), "");