GitLab

This is needed now that we use an unordered_map with a KmerAffect (see
previous commit) as explained here:
https://stackoverflow.com/questions/17016175/c-unordered-map-using-a-custom-class-type-as-the-key

max12() actually didn't require a CountKmerAffectAnalyser.
The CountKmerAffectAnalyser builds a data structure to improve
KmerAffect counting at any position. But this was not needed for the max12() function

We absolutely don't need to call getDistinctAffectations to destroy the objects

Resolve "Erreur si clones null dans un fichier vidjil côté serveur"

Closes #3555

See merge request !329

Release 2019.04, doc, release

See merge request !462

Release 2019.04

See merge request !461

see #3891

see #3891

Algo: output equal score alternative genes

Closes #3414

See merge request !459

Fix #3414

IGHJ5*01 and IGHJ5*02 are equally good. Without #3414
we can have either sequences.

Alignment:
read             gactactggggccagggaaccctggtcaccgtctcctcag
IGHJ4*01   8     ..............A.........................
IGHJ4*02   8     ........................................
IGHJ4*02   8     ..............A..G......................
IGHJ5*01  11     ....C.........A.........................
IGHJ5*02  11     ...CC...................................

tests: this test can fail on some platforms

See merge request !458

See #3414 and 68b6ebcb.

Merge branch 'feature-c/2041-l-alignement-multiple-plante-quand-la-premiere-sequence-est-retiree' into 'dev'

Resolve "L'alignement multiple plante quand la première séquence est retirée"

Closes #2041

See merge request !454

--config, --labels-json

Closes #3839 and #3837

See merge request !456

Closes #3837, #3839.

See #3839.

See #3839

Opens #3839.

See #3837.

see #3837.

There is now some hack to get a json, it could be improved.
See #3837.

https://github.com/CLIUtils/CLI11/commit/2ae5598d9570a

Opens #3837.

link to #2041

In this case, ignore this function call (update_first_clone)
link to #2041

link to #2041

link to #2041

link to #2041