GitLab

It will depend on the order in which reads are coming when computing
the representative but this order is random. What is important is that
we find a representative of the correct length with the correct sequence
whatever the read name and read positions are.

It is hard to predict the result is not totally deterministic
(as is the case with the RandomScorer, which is now by default,
whose results depend on the pseudo-random generator that may
differ depending on the OSes)

See #3866

see #3866

Closes #3762.

see #3762

see #3762

See #3762. We have --extra

see #3206

see #3206

Fix #3414

IGHJ5*01 and IGHJ5*02 are equally good. Without #3414
we can have either sequences.

Alignment:
read             gactactggggccagggaaccctggtcaccgtctcctcag
IGHJ4*01   8     ..............A.........................
IGHJ4*02   8     ........................................
IGHJ4*02   8     ..............A..G......................
IGHJ5*01  11     ....C.........A.........................
IGHJ5*02  11     ...CC...................................

See #3414 and 68b6ebcb.

Closes #3837, #3839.

Opens #3839.

Opens #3837.

Following should#43, we cannot anymore use 'B' here.

Following the fix on min_cover_representative.
The representative on small datasets may be longer.

Thus we need to update those. There also some side effects:
- V genes are less ambiguous (hence less warnings)
- Consensus is longer (hence less warnings too)
- Positions changes of end of V, J, CDR3…

Checks previous commit

See #3792.

see #3789

See #3785.

Use the new option names.
Remove also '--trim 0' options used in some tests.

See #3295.

Otherwise the .* was put between the alternatives which lead to a different behaviour for the last alternative

Fix #3784

On each line we should have a + or - when segmented or an exclamation mark
when unsegmented.
A tab should always exist at least between the sequence name and the VDJ designation.

This should ease parsing the output.

see also should#31

close #3772.

was done twice in 40aef950 and 556d8b0b, but git merge
did not understood what we meant there ;-)