1. 28 Jul, 2016 1 commit
  2. 13 Jul, 2016 1 commit
  3. 11 Jul, 2016 1 commit
  4. 06 Jul, 2016 3 commits
  5. 14 Apr, 2016 1 commit
  6. 01 Mar, 2016 2 commits
  7. 06 Feb, 2016 2 commits
  8. 21 Jan, 2016 1 commit
    • Mathieu Giraud's avatar
      tests: update tests, -e 10 for Stanford_S22.fasta · 88c3213c
      Mathieu Giraud authored
      With the new estimation of the p-value in affectanalyser.cpp, the following sequence
      has a p-value on the J side of about 3.58e-04, yielding an e-value of about 4.71 (there are 13,153 reads in Stanford-S22).
      
      Setting -e 10 enables thus this sequence to be still segmented.
      Changing seeds could maybe change these results.
      
      ===
      
      >lcl|FLN1FA001D7OE0.1
      GGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTGCCATATCGGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGTTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTATTGTGCGAGAGTAGCAGCGGCTGCTCTTGACTCCTTGGGGCCAGGGAAGCCTGGTCACCTCTCCTCAGG
      73 + VJ      0 158 187 220    seed IGH SEG_+ 3.583786e-04 2.531831e-182/3.583786e-04
       _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _ _ _+X _ _ _ _ _ _ _+X _ _ _ _ _ _+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _ _ _+X _ _ _ _ _ _+X+X ?+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _+X+X+X _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _+x _ _ _ _ _ _+x _ _ _ _ _ _ _ _ _ _ _ _ _ _
      88c3213c
  9. 15 Jan, 2016 1 commit
  10. 22 Dec, 2015 1 commit
  11. 28 May, 2015 1 commit
  12. 21 May, 2015 1 commit
  13. 11 May, 2015 2 commits
    • Mathieu Giraud's avatar
      tests: stanford-*.should_get, faster tests · bf0c408a
      Mathieu Giraud authored
      The tests using Stanford-S22 mostly test things on the extracted windows,
      sometimes on the representatives, but almost never on the fine segmentation.
      We thus add '-y 0', '-z 0', or similar options to these tests.
      
      On some laptop, running all *.should_get tests now takes 2'34 instead of 3'48.
      bf0c408a
    • Mikaël Salson's avatar
      tests: Update tests with new default -t option · d317535b
      Mikaël Salson authored and Mathieu Giraud's avatar Mathieu Giraud committed
      Interestingly with -w 100, the number of foud windows is much larger
      because now the window is better centered around the junction.
      Before we could have spurious hits in the N-REGION which would
      have shifted the window towards the 3' end.
      
      Additionnally a few windows seem to be factorised.
      
      (updated/merged by @magiraud)
      d317535b
  14. 16 Apr, 2015 1 commit
  15. 11 Apr, 2015 1 commit
    • Mathieu Giraud's avatar
      tests: update tests for e-value · 5822e2a6
      Mathieu Giraud authored
      - stanford*: one sequence in S22 is not segmented
      - trd-dd2-dd3*: the short Dd2-Dd3 example has a evalue slightly above 1.0, we set -e 10
      - chimera:  one failed test is now passing thanks to e-value
      5822e2a6
  16. 24 Feb, 2015 1 commit
  17. 20 Feb, 2015 1 commit
  18. 25 Nov, 2014 1 commit
  19. 22 Oct, 2014 1 commit
    • Mikaël Salson's avatar
      Vidjil: change output filenames · 756ef3c2
      Mikaël Salson authored
      * .data files are renamed to .vidjil
      * by default output filenames have the same basename as the input file
      
      Documentation and tests have been updated accordingly
      756ef3c2
  20. 20 Oct, 2014 1 commit
  21. 10 Oct, 2014 1 commit
  22. 26 Aug, 2014 1 commit