This will help testing the effect of some parameter on all the functional tests.

We should follow format-analysis.org specification: "Positions on the sequence start at 1."
Note that these tests were introduced in 745b47db (Feb 2016), but, at this time, we did not check these positions.

This will be more flexible.

This is the only test checking the raw json output.

With the new estimation of the p-value in affectanalyser.cpp, the following sequence
has a p-value on the J side of about 3.58e-04, yielding an e-value of about 4.71 (there are 13,153 reads in Stanford-S22).

Setting -e 10 enables thus this sequence to be still segmented.
Changing seeds could maybe change these results.

===

>lcl|FLN1FA001D7OE0.1
GGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTGCCATATCGGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGTTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTATTGTGCGAGAGTAGCAGCGGCTGCTCTTGACTCCTTGGGGCCAGGGAAGCCTGGTCACCTCTCCTCAGG
73 + VJ      0 158 187 220    seed IGH SEG_+ 3.583786e-04 2.531831e-182/3.583786e-04
 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _ _ _+X _ _ _ _ _ _ _+X _ _ _ _ _ _+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _ _ _+X _ _ _ _ _ _+X+X ?+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _+X+X+X _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _+x _ _ _ _ _ _+x _ _ _ _ _ _ _ _ _ _ _ _ _ _

Make sure that sequence is output (and evalue) even when we have no FineSegmentation

More sequences are segmented in Standford_S22

It's time to use the nice feature introduced in 15e5ca.

The tests using Stanford-S22 mostly test things on the extracted windows,
sometimes on the representatives, but almost never on the fine segmentation.
We thus add '-y 0', '-z 0', or similar options to these tests.

On some laptop, running all *.should_get tests now takes 2'34 instead of 3'48.

Mikaël Salson authored May 11, 2015 and Mathieu Giraud committed May 11, 2015

Interestingly with -w 100, the number of foud windows is much larger
because now the window is better centered around the junction.
Before we could have spurious hits in the N-REGION which would
have shifted the window towards the 3' end.

Additionnally a few windows seem to be factorised.

(updated/merged by @magiraud)

- stanford*: one sequence in S22 is not segmented
- trd-dd2-dd3*: the short Dd2-Dd3 example has a evalue slightly above 1.0, we set -e 10
- chimera:  one failed test is now passing thanks to e-value

.json elements are sorted now by keys.

format_json.py raises an exception if the JSON is not valid.
Using format_json.py needs to slightly rewrite the test
(spaces are deleted, and the order may not be the same).

Additionally, one test has a different output due to a previously forgotten '-d' option.

* .data files are renamed to .vidjil
* by default output filenames have the same basename as the input file

Documentation and tests have been updated accordingly

(and we should decide whether .data should be output on '-c windows')