Attention une mise à jour du serveur va être effectuée le lundi 17 mai entre 13h et 13h30. Cette mise à jour va générer une interruption du service de quelques minutes.

  1. 04 Feb, 2016 4 commits
  2. 03 Feb, 2016 5 commits
  3. 02 Feb, 2016 9 commits
  4. 01 Feb, 2016 9 commits
  5. 28 Jan, 2016 5 commits
  6. 26 Jan, 2016 6 commits
  7. 21 Jan, 2016 2 commits
    • Mikaël Salson's avatar
      revcomp.should_get: Test that the same e-value appears twice · d3efe5e2
      Mikaël Salson authored
      We prefix the e-values with a string "e-value:" to make sure that we are matching e-values.
      d3efe5e2
    • Mathieu Giraud's avatar
      tests: update tests, -e 10 for Stanford_S22.fasta · 88c3213c
      Mathieu Giraud authored
      With the new estimation of the p-value in affectanalyser.cpp, the following sequence
      has a p-value on the J side of about 3.58e-04, yielding an e-value of about 4.71 (there are 13,153 reads in Stanford-S22).
      
      Setting -e 10 enables thus this sequence to be still segmented.
      Changing seeds could maybe change these results.
      
      ===
      
      >lcl|FLN1FA001D7OE0.1
      GGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTGCCATATCGGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGTTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTATTGTGCGAGAGTAGCAGCGGCTGCTCTTGACTCCTTGGGGCCAGGGAAGCCTGGTCACCTCTCCTCAGG
      73 + VJ      0 158 187 220    seed IGH SEG_+ 3.583786e-04 2.531831e-182/3.583786e-04
       _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _ _ _+X _ _ _ _ _ _ _+X _ _ _ _ _ _+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _ _ _+X _ _ _ _ _ _+X+X ?+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _+X+X+X _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _+x _ _ _ _ _ _+x _ _ _ _ _ _ _ _ _ _ _ _ _ _
      88c3213c