1. 01 Apr, 2019 3 commits
  2. 22 Mar, 2019 3 commits
    • Mikaël Salson's avatar
      algo/tests: Update tests on representative · 903430f8
      Mikaël Salson authored
      Following the fix on min_cover_representative.
      The representative on small datasets may be longer.
      
      Thus we need to update those. There also some side effects:
      - V genes are less ambiguous (hence less warnings)
      - Consensus is longer (hence less warnings too)
      - Positions changes of end of V, J, CDR3…
      903430f8
    • Mikaël Salson's avatar
      algo/tests: Add test on min_cover_representative · 77e91ad1
      Mikaël Salson authored
      Checks previous commit
      77e91ad1
    • Mikaël Salson's avatar
      vidjil.cpp: Fix definition of min_cover_representative · 5c9296f9
      Mikaël Salson authored
      min_cover_representative should be seen as a strict minimum on the number of reads
      that can support a representative sequence.
      The purpose is to avoid a too low ABSOLUTE number of reads to define a representative.
      For the relative number, it is ratio_representative's role.
      
      Before, if we specified -r 100 we needed to have 100 corresponding
      k-mers which is very strict when a clone has just slightly more than
      100 reads
      5c9296f9
  3. 21 Mar, 2019 5 commits
  4. 14 Mar, 2019 2 commits
  5. 12 Mar, 2019 2 commits
  6. 11 Mar, 2019 4 commits
  7. 08 Mar, 2019 7 commits
  8. 07 Mar, 2019 2 commits
  9. 06 Mar, 2019 9 commits
  10. 05 Mar, 2019 3 commits
    • Mathieu Giraud's avatar
      tests: update number of options · 694f786d
      Mathieu Giraud authored
      was done twice in 40aef950 and 556d8b0b, but git merge
      did not understood what we meant there ;-)
      694f786d
    • Mathieu Giraud's avatar
      tests: update e-value · 8113aaf9
      Mathieu Giraud authored
      see #3773
      8113aaf9
    • Mikaël Salson's avatar
      algo/tests: Test the --consensus-on-random-sample option · a5694371
      Mikaël Salson authored
      The dataset was generated to have a minority of sequences with a TTT insertion
      which would make it the sequence of choice with the default ReadScore (based
      on length and quality).
      
      On the contrary with a random sampler we should not be impacted by this
      insertion as it happens in the minority of sequences.
      
      Here is the command that generated the dataset:
      for i in $(seq 1 3500); do
        if [ $((RANDOM%3)) -ne 0 ]; then
          echo ">seq$i";
          echo ctacctactactgtgccttgtgggaggtgatagtagtgattggatcaag;
        else
          echo ">seq$i";
          echo cTTTtacctactactgtgccttgtgggaggtgatagtagtgattggatcaag;
        fi;
      done > test-random-consensus.fa
      a5694371