GitLab

see #3762

See #3762. We have --extra

see #3206

see #3206

Fix #3414

IGHJ5*01 and IGHJ5*02 are equally good. Without #3414
we can have either sequences.

Alignment:
read             gactactggggccagggaaccctggtcaccgtctcctcag
IGHJ4*01   8     ..............A.........................
IGHJ4*02   8     ........................................
IGHJ4*02   8     ..............A..G......................
IGHJ5*01  11     ....C.........A.........................
IGHJ5*02  11     ...CC...................................

See #3414 and 68b6ebcb.

Closes #3837, #3839.

Opens #3839.

Opens #3837.

Following should#43, we cannot anymore use 'B' here.

Following the fix on min_cover_representative.
The representative on small datasets may be longer.

Thus we need to update those. There also some side effects:
- V genes are less ambiguous (hence less warnings)
- Consensus is longer (hence less warnings too)
- Positions changes of end of V, J, CDR3…

Checks previous commit

See #3792.

see #3789

See #3785.

Use the new option names.
Remove also '--trim 0' options used in some tests.

See #3295.

Otherwise the .* was put between the alternatives which lead to a different behaviour for the last alternative

Fix #3784

On each line we should have a + or - when segmented or an exclamation mark
when unsegmented.
A tab should always exist at least between the sequence name and the VDJ designation.

This should ease parsing the output.

see also should#31

close #3772.

was done twice in 40aef950 and 556d8b0b, but git merge
did not understood what we meant there ;-)

see #3773

The dataset was generated to have a minority of sequences with a TTT insertion
which would make it the sequence of choice with the default ReadScore (based
on length and quality).

On the contrary with a random sampler we should not be impacted by this
insertion as it happens in the minority of sequences.

Here is the command that generated the dataset:
for i in $(seq 1 3500); do
  if [ $((RANDOM%3)) -ne 0 ]; then
    echo ">seq$i";
    echo ctacctactactgtgccttgtgggaggtgatagtagtgattggatcaag;
  else
    echo ">seq$i";
    echo cTTTtacctactactgtgccttgtgggaggtgatagtagtgattggatcaag;
  fi;
done > test-random-consensus.fa

Executing valgrind can take more time, thus we need to increase the default timeout to make
sure the program has time to properly execute.

See 1a7bb7f8 for reason why.

Fix (in part?) #3771

Some old slaves may work better with less germlines.
At least this separates independant tests.

See #3652.