1. 19 Apr, 2019 4 commits
  2. 18 Apr, 2019 2 commits
  3. 04 Apr, 2019 2 commits
  4. 03 Apr, 2019 1 commit
  5. 02 Apr, 2019 4 commits
  6. 01 Apr, 2019 3 commits
  7. 22 Mar, 2019 2 commits
  8. 14 Mar, 2019 1 commit
  9. 12 Mar, 2019 1 commit
  10. 11 Mar, 2019 2 commits
  11. 08 Mar, 2019 4 commits
  12. 07 Mar, 2019 2 commits
  13. 06 Mar, 2019 4 commits
  14. 05 Mar, 2019 4 commits
    • Mathieu Giraud's avatar
      tests: update number of options · 694f786d
      Mathieu Giraud authored
      was done twice in 40aef950 and 556d8b0b, but git merge
      did not understood what we meant there ;-)
    • Mathieu Giraud's avatar
      tests: update e-value · 8113aaf9
      Mathieu Giraud authored
      see #3773
    • Mikaël Salson's avatar
      algo/tests: Test the --consensus-on-random-sample option · a5694371
      Mikaël Salson authored
      The dataset was generated to have a minority of sequences with a TTT insertion
      which would make it the sequence of choice with the default ReadScore (based
      on length and quality).
      On the contrary with a random sampler we should not be impacted by this
      insertion as it happens in the minority of sequences.
      Here is the command that generated the dataset:
      for i in $(seq 1 3500); do
        if [ $((RANDOM%3)) -ne 0 ]; then
          echo ">seq$i";
          echo ctacctactactgtgccttgtgggaggtgatagtagtgattggatcaag;
          echo ">seq$i";
          echo cTTTtacctactactgtgccttgtgggaggtgatagtagtgattggatcaag;
      done > test-random-consensus.fa
    • Mathieu Giraud's avatar
      tests: update · 40aef950
      Mathieu Giraud authored
  15. 04 Mar, 2019 2 commits
  16. 01 Mar, 2019 2 commits