GitLab

see #3762

See #3762. We have --extra

see #3206

see #3206

Fix #3414

IGHJ5*01 and IGHJ5*02 are equally good. Without #3414
we can have either sequences.

Alignment:
read             gactactggggccagggaaccctggtcaccgtctcctcag
IGHJ4*01   8     ..............A.........................
IGHJ4*02   8     ........................................
IGHJ4*02   8     ..............A..G......................
IGHJ5*01  11     ....C.........A.........................
IGHJ5*02  11     ...CC...................................

See #3414 and 68b6ebcb.

Closes #3837, #3839.

See #3839.

See #3839

Opens #3839.

See #3837.

see #3837.

There is now some hack to get a json, it could be improved.
See #3837.

https://github.com/CLIUtils/CLI11/commit/2ae5598d9570a

Opens #3837.

Following should#43, we cannot anymore use 'B' here.

Following the fix on min_cover_representative.
The representative on small datasets may be longer.

Thus we need to update those. There also some side effects:
- V genes are less ambiguous (hence less warnings)
- Consensus is longer (hence less warnings too)
- Positions changes of end of V, J, CDR3…

Checks previous commit

min_cover_representative should be seen as a strict minimum on the number of reads
that can support a representative sequence.
The purpose is to avoid a too low ABSOLUTE number of reads to define a representative.
For the relative number, it is ratio_representative's role.

Before, if we specified -r 100 we needed to have 100 corresponding
k-mers which is very strict when a clone has just slightly more than
100 reads

Better than what was done in 5359314cb.

Same spirit than 7130f076 and 87b23f58 on updated upstream.
We should discuss and/or make a pull request to upstream, see #3854.

see #3766

See #3792.

see #3789