Une MAJ de sécurité est nécessaire sur notre version actuelle. Elle sera effectuée lundi 02/08 entre 12h30 et 13h. L'interruption de service devrait durer quelques minutes (probablement moins de 5 minutes).

  1. 01 Apr, 2021 4 commits
  2. 11 Feb, 2021 1 commit
  3. 04 Dec, 2020 2 commits
  4. 11 Jun, 2020 4 commits
  5. 26 Mar, 2020 1 commit
  6. 06 Jan, 2020 1 commit
  7. 26 Sep, 2019 1 commit
    • flothoni's avatar
      tools/test; add some test on fuse · ab95592c
      flothoni authored
      Test the capacity to compute distribution on all clones before top cutting
      Test the capacity to return rounded distribution axe
      Update an assert
      Link to #3978
      ab95592c
  8. 24 Sep, 2019 1 commit
  9. 22 Aug, 2019 1 commit
  10. 08 Jul, 2019 1 commit
  11. 02 Apr, 2019 2 commits
  12. 22 Mar, 2019 1 commit
  13. 07 Mar, 2019 1 commit
  14. 05 Mar, 2019 1 commit
    • Mikaël Salson's avatar
      algo/tests: Test the --consensus-on-random-sample option · a5694371
      Mikaël Salson authored
      The dataset was generated to have a minority of sequences with a TTT insertion
      which would make it the sequence of choice with the default ReadScore (based
      on length and quality).
      
      On the contrary with a random sampler we should not be impacted by this
      insertion as it happens in the minority of sequences.
      
      Here is the command that generated the dataset:
      for i in $(seq 1 3500); do
        if [ $((RANDOM%3)) -ne 0 ]; then
          echo ">seq$i";
          echo ctacctactactgtgccttgtgggaggtgatagtagtgattggatcaag;
        else
          echo ">seq$i";
          echo cTTTtacctactactgtgccttgtgggaggtgatagtagtgattggatcaag;
        fi;
      done > test-random-consensus.fa
      a5694371
  15. 28 Feb, 2019 1 commit
  16. 04 Dec, 2018 1 commit
  17. 20 Jul, 2018 2 commits
  18. 12 Jul, 2018 2 commits
    • Mikaël Salson's avatar
      data/segmentation-2.fa: Small change in random sequence · 18ce10f2
      Mikaël Salson authored
      That random sequence was supposed to have too few v/j information (because
      it's random!). However, because of bad luck there was some tiny similarities
      with IGH but the sequence was not segmented due to inconsistencies with the
      strand.
      This is still cool because the random sequence is not segmented. However here
      we just want to test that a sequence with too few v/j is reported as such. As
      the strand consistency is tested first in our algorithm, we didn't report the
      too few v/j information. Therefore I modified a single nucleotide in the
      sequence to get rid of this strand inconsistency.
      
      I think I always feel guilty when modifying a test example. That's probably
      why I needed to make such a long comment.
      
      See !148
      18ce10f2
    • Mikaël Salson's avatar
      data/chimera-fake-half.fa: cgcgcgcg is not a good example · f5c1d159
      Mikaël Salson authored
      It appears in TRBJ2-5*01 which leads to false positives.
      The purpose of our dimer was only to have some rubbish sequence.
      Thus I have no qualms about changing it.
      
      Désolé pour le côté scatologique du dimer.
      
      See MR !148
      f5c1d159
  19. 11 Jul, 2018 1 commit
  20. 07 Jul, 2018 1 commit
    • Mikaël Salson's avatar
      algo/tests: Bad filtering with -Z 1 · 30c16f63
      Mikaël Salson authored
      Sequece aligned with -Z 1 is IGHV4-59*06 while it should be IGHV4-31*0[23].
      
      IGHV4-59*06 is a pretty good choice for this sequence as it has 100% identity
      however it is 4nt shorter compared to IGHV4-31*0[23] (which also have 100% identity).
      
      Example for #3344.
      30c16f63
  21. 05 Jul, 2018 1 commit
  22. 13 Jun, 2018 1 commit
  23. 04 Jun, 2018 1 commit
  24. 25 May, 2018 2 commits
  25. 01 Feb, 2018 2 commits
  26. 19 Jan, 2018 1 commit
  27. 18 Jan, 2018 1 commit
  28. 17 Jan, 2018 1 commit