1. 03 Feb, 2016 5 commits
  2. 02 Feb, 2016 9 commits
  3. 01 Feb, 2016 9 commits
  4. 28 Jan, 2016 5 commits
  5. 26 Jan, 2016 6 commits
  6. 21 Jan, 2016 6 commits
    • Mikaël Salson's avatar
      revcomp.should_get: Test that the same e-value appears twice · d3efe5e2
      Mikaël Salson authored
      We prefix the e-values with a string "e-value:" to make sure that we are matching e-values.
      d3efe5e2
    • Mathieu Giraud's avatar
      tests: update tests, -e 10 for Stanford_S22.fasta · 88c3213c
      Mathieu Giraud authored
      With the new estimation of the p-value in affectanalyser.cpp, the following sequence
      has a p-value on the J side of about 3.58e-04, yielding an e-value of about 4.71 (there are 13,153 reads in Stanford-S22).
      
      Setting -e 10 enables thus this sequence to be still segmented.
      Changing seeds could maybe change these results.
      
      ===
      
      >lcl|FLN1FA001D7OE0.1
      GGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTGCCATATCGGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGTTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTATTGTGCGAGAGTAGCAGCGGCTGCTCTTGACTCCTTGGGGCCAGGGAAGCCTGGTCACCTCTCCTCAGG
      73 + VJ      0 158 187 220    seed IGH SEG_+ 3.583786e-04 2.531831e-182/3.583786e-04
       _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _ _ _+X _ _ _ _ _ _ _+X _ _ _ _ _ _+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _ _ _+X _ _ _ _ _ _+X+X ?+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _+X+X+X _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _+x _ _ _ _ _ _+x _ _ _ _ _ _ _ _ _ _ _ _ _ _
      88c3213c
    • Mathieu Giraud's avatar
      tests: update tests · 96eb0706
      Mathieu Giraud authored
      This test should be changed to actually check the debug options rather than borderline (un)segmentation cases.
      96eb0706
    • Mathieu Giraud's avatar
      tests: update tests, chimera-fake-half.should_get · 53896876
      Mathieu Giraud authored
      The TODO comment: "a more precise modeling should give a e-value computation that could make this work even with -e 1"
      is still very pertinent.
      53896876
    • Mathieu Giraud's avatar
      tests: update tests · 40e94451
      Mathieu Giraud authored
      This test should check whether the e-values are the same, and not their actual value.
      40e94451
    • Mathieu Giraud's avatar
      core/affectanalyser.cpp: safer p-value estimation, taking into account the central region · 2e23e720
      Mathieu Giraud authored
      As detected by @mikael-s in the parent commit, the region between V and J affectations
      was not taken into account in the p-values, yielding erroneous segmentations
      when this region was very large.
      
      Now this region is counted *both* for the computation of left and right p-values, solving
      the bug of the parent commit.
      
      This could be sometimes over-conservative : are we counting things twice ?
      In regular situations, the answer is no, as the p-values
      are eventually computed by getProbabilityAtLeastOrAbove in kmerstore.h,
      that takes into account the length of the seed.
      
      A more exact option could have been to use something like
      (first_pos_max + last_pos_max / 2) + getS()/2, but it would raise symmetry problems.
      The selected option should anyway improve the estimation in most of the cases.
      2e23e720