1. 26 Feb, 2015 1 commit
  2. 25 Nov, 2014 1 commit
  3. 09 Sep, 2014 1 commit
  4. 25 Jul, 2014 1 commit
  5. 07 Jul, 2014 1 commit
    • Mikaël Salson's avatar
      Tests: Less windows found in Stanford S22 with -w 100 · c50c44c2
      Mikaël Salson authored
      No worries this comes from the fact that this tests uses a very large
      window. Therefore a slight modification of the segmentation may shift the
      segmentation to the right and may prevent from getting a window.
      
      There were several cases with an affectation like that one:
      +V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V ?+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V ?+V+V+V+V+V+V+V+V ? ? ?+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V ?+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V ?+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V+V _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _+V _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _+V _ _ _ _ _ _ _ _ _+J+J ?+J+J+J+J+J+J+J+J+J+J+J+J+J+J+J+J+J+J+J+J+J+J+J ?+J+J+J+J
      
      Where the last +V was not taken into account with the previous heuristic, but
      was with the current one.
      c50c44c2
  6. 16 Apr, 2014 1 commit
    • Mikaël Salson's avatar
      Affect: Bug correction regarding different strands with Kmer(String)Affect · 5f63020a
      Mikaël Salson authored
      When a k-mer, for the same label, is seen on both strand, we were (actually, I
      was) putting the + strand by default. But that's not robust to revcomp
      sequences. That explains some different results on strand + and strand - on
      very specific cases (mainly with small k).
      
      Results from test stanford-w100 is updated accordingly.
      5f63020a
  7. 15 Apr, 2014 1 commit
  8. 03 Apr, 2014 1 commit
  9. 01 Apr, 2014 2 commits
  10. 25 Mar, 2014 2 commits
    • Mikaël Salson's avatar
      Tests: Changes in germline dataset · 9c2b6a90
      Mikaël Salson authored
      Changes in some sequences (in particular IGHV7-40*03) are responsible for
      those number changes. There is no such changes when using the previous
      germline dataset.
      
      For information IGHV7-40*03 changed from:
      >Z12320|IGHV7-40*03|Homo sapiens|P|V-REGION|1..291|289 nt|1| | | | |289+0=289|partial in 5'| |
      ctgcagctggtgcagtctgggcctgaggtgaagaagcctggggcctcagtgaaggtctcc
      tataagtcttctggttacaccttcaccatctatggtatgaattgggtatgatagacccct
      ggacagggctttgagtggatgtgatggatcatcacctacactgggaacccaacgtatacc
      cacggcttcacaggatggtttgtcttctccatggacacgtctgtcagcacggcgtgtctt
      cagatcagcagcctaaaggctgaggacacggccgagtattactgtgcga
      to:
      >AC241995|IGHV7-40*03|Homo sapiens|P|V-REGION|10101..10396|296 nt|1| | | | |296+0=296| | |
      ttttcaatagaaaagtcaaataatctaagtgtcaatcagtggatgattagataaaatatg
      atatatgtaaatcatggaatactatgcagccagtatggtatgaattcagtgtgaccagcc
      cctggacaagggcttgagtggatgggatggatcatcacctacactgggaacccaacatat
      accaacggcttcacaggacggtttctattctccatggacacctctgtcagcatggcgtat
      ctgcagatcagcagcctaaaggctgaggacacggccgtgtatgactgtatgagaga
      9c2b6a90
    • Mikaël Salson's avatar
      Tests: Default behaviour changed in Vidjil · 80d0e0d6
      Mikaël Salson authored
      Maybe we don't need to monitor default behaviour changes in every test.
      So I set the seed as a parameter to avoid test failures.
      80d0e0d6
  11. 20 Feb, 2014 1 commit
    • Mathieu Giraud's avatar
      Vidjil: release 2014.02 · 113ee8ee
      Mathieu Giraud authored
      	* Refactored main vidjil.cpp (core/windows.cpp, core/windowExtractor.cpp)
      	* Removed unused html output
      	* Better json output (core/json.cpp)
      	* Updated main stdout, with representative sequence for each clone
      	* Updated parameters for FineSegmenter (delta_max) and dynprog (substition cost)
      	* Bugs closed
      113ee8ee
  12. 07 Oct, 2013 1 commit
    • Mikaël Salson's avatar
      Vidjil: release 2013.10 · 2cbd3725
      Mikaël Salson authored
      	* Better heuristic, segments more reads (core/segment.cpp)
      	* Better and faster selection of representative read (vidjil.cpp, core/read_chooser.cpp)
      	* Better display of reason of non-segmenting reads
      	* New normalization against a standard (-Z) (core/labels.cpp)
      	* New experimental lazy_msa multiple aligner
      	* New .json output
      	* New unit tests
      	* Bugs closed
      2cbd3725