Attention une mise à jour du serveur va être effectuée le lundi 17 mai entre 13h et 13h30. Cette mise à jour va générer une interruption du service de quelques minutes.

  1. 04 Apr, 2019 1 commit
    • Mikaël Salson's avatar
      alternative_genes.should-get: Cannot determine the third alternative gene · 0a23db36
      Mikaël Salson authored
      IGHJ5*01 and IGHJ5*02 are equally good. Without #3414
      we can have either sequences.
      read             gactactggggccagggaaccctggtcaccgtctcctcag
      IGHJ4*01   8     ..............A.........................
      IGHJ4*02   8     ........................................
      IGHJ4*02   8     ..............A..G......................
      IGHJ5*01  11     ....C.........A.........................
      IGHJ5*02  11     ...CC...................................
  2. 03 Apr, 2019 3 commits
  3. 02 Apr, 2019 23 commits
  4. 01 Apr, 2019 7 commits
  5. 29 Mar, 2019 6 commits