Commit ff13d9c1 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: update a borderline artificial TRG sequence

Previous e-value was 0.0094, with the new germlines it was 0.0117.
The sequence is lengthened with one nucleotide.
parent 8ad4add9
......@@ -37,4 +37,4 @@ cttgggcagttggaacaacACTTGTTGTCACAG
gaattattataagaaactctttggcagtggaacaacactggttgtcac
>seq-seg-no-window
ctgggacaggGAATTATTAT
ctgggacaggGAATTATTATA
......@@ -341,7 +341,7 @@ void testExtractor(IndexTypes index) {
TAP_TEST_EQUAL(we.getAverageSegmentationLength(UNSEG_ONLY_J), 42.75, TEST_EXTRACTOR_AVG_LENGTH, "average: " << we.getAverageSegmentationLength(UNSEG_ONLY_J));
TAP_TEST_EQUAL(we.getAverageSegmentationLength(UNSEG_ONLY_V), 48, TEST_EXTRACTOR_AVG_LENGTH, "average: " << we.getAverageSegmentationLength(UNSEG_ONLY_V));
TAP_TEST_EQUAL(we.getAverageSegmentationLength(UNSEG_AMBIGUOUS), 72, TEST_EXTRACTOR_AVG_LENGTH, "average: " << we.getAverageSegmentationLength(UNSEG_AMBIGUOUS));
TAP_TEST_EQUAL(we.getAverageSegmentationLength(UNSEG_TOO_SHORT_FOR_WINDOW), 20, TEST_EXTRACTOR_AVG_LENGTH, "average: " << we.getAverageSegmentationLength(UNSEG_TOO_SHORT_FOR_WINDOW));
TAP_TEST_EQUAL(we.getAverageSegmentationLength(UNSEG_TOO_SHORT_FOR_WINDOW), 21, TEST_EXTRACTOR_AVG_LENGTH, "average: " << we.getAverageSegmentationLength(UNSEG_TOO_SHORT_FOR_WINDOW));
TAP_TEST_EQUAL(we.getAverageSegmentationLength(TOTAL_SEG_AND_WINDOW), 71, TEST_EXTRACTOR_AVG_LENGTH, "average: " << we.getAverageSegmentationLength(TOTAL_SEG_AND_WINDOW));
TAP_TEST(out_seg.tellp() > 0, TEST_EXTRACTOR_OUT_SEG, "");
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment