Merge branch 'feature-a/2828-output-airr' into 'dev'

Feature a/2828 output airr

See merge request !330

algo/core/output.cpp

 
 #include "output.h"
 
+#define NULL_VAL ""
+
+string getout(json v)
+{
+  if (v.is_null()) return NULL_VAL ;
+  if (v.is_number()) return string_of_int(v) ;
+  if (v.is_string()) return v;
+  return v.dump();
+}
+
+string Output::get(string key)
+{
+  return getout(j[key]);
+}
+string Output::get(string key, string subkey)
+{
+  return getout(j[key][subkey]);
+}
+string Output::get(string key, string subkey, string subsubkey)
+{
+  return getout(j[key][subkey][subsubkey]);
+}
+
 
 void Output::set(string key, json val)
 {
@@ -27,6 +50,17 @@ void Output::add_warning(string code, string msg, string level)
   json_add_warning(j, code, msg, level);
 }
 
+
+int CloneOutput::reads()
+{
+  return j["reads"][0];
+}
+
+
+CloneOutput::~CloneOutput()
+{
+}
+
 json CloneOutput::toJson()
 {
    return j;
@@ -69,7 +103,7 @@ CloneOutput* SampleOutput::getClone(junction junction)
   }
 }
 
-
+// .vidjil json output
 
 void SampleOutputVidjil::out(ostream &s)
 {
@@ -82,3 +116,51 @@ void SampleOutputVidjil::out(ostream &s)
 
    s << j.dump(2);
 }
+
+
+// AIRR .tsv output
+
+map <string, string> CloneOutputAIRR::fields()
+{
+  map <string, string> fields;
+
+  fields["locus"] = get("germline");
+  fields["consensus_count"] = string_of_int(reads());
+
+  fields["sequence_id"] = get("id");
+  fields["clone_id"] = get("id");
+  fields["sequence"] = get("sequence");
+  fields["v_call"] = get(KEY_SEG, "5", "name");
+  fields["d_call"] = get(KEY_SEG, "4", "name");
+  fields["j_call"] = get(KEY_SEG, "3", "name");
+
+  return fields;
+}
+
+void SampleOutputAIRR::out(ostream &s)
+{
+  vector <string> fields = {
+    "locus",
+    "consensus_count",
+    "v_call", "d_call", "j_call",
+    "sequence_id",
+    "sequence",
+    "sequence_alignment",
+    "germline_alignment",
+    "v_cigar", "d_cigar", "j_cigar",
+    "clone_id"
+  };
+
+
+  for (string f: fields)
+    s << f << "\t" ;
+  s << endl ;
+
+  for (auto it: clones)
+  {
+    map <string, string> clone_fields = static_cast<CloneOutputAIRR *>(it.second) -> fields();
+    for (string f: fields)
+      s << clone_fields[f] << "\t" ;
+    s << endl;
+  }
+}

algo/core/output.h

@@ -18,16 +18,26 @@ protected:
   json j;
   
 public:
+  string get(string key);
+  string get(string key, string subkey);
+  string get(string key, string subkey, string subsubkey);
+
   void set(string key, json val);
   void set(string key, string subkey, json val);
   void set(string key, string subkey, string subsubkey, json val);
+
   void add_warning(string code, string msg, string level);
+
 };
 
 
 class CloneOutput : public Output
 {
 public:
+  virtual ~CloneOutput();
+
+  int reads();
+
   void setSeg(string subkey, json val);
 
   json toJson();
@@ -53,27 +63,24 @@ public:
 };
 
 
-/*
-class CloneOutputFormatter
-{
-
-}
-
-class CloneOutputFormatterCSV(CloneOutputFormatter)
+// Native Json .vidjil format
+// See vidjil-format.md
+class SampleOutputVidjil : public SampleOutput
 {
+public:
+  void out(ostream &s);
+};
 
-}
-
-class CloneOutputFormatterJson(CloneOutputFormatter)
+// AIRR
+// See http://docs.airr-community.org
+class CloneOutputAIRR : public CloneOutput
 {
+public:
+  void out(ostream &s);
+  map <string, string> fields();
+};
 
-}
-*/
-
-
-// Native Json .vidjil format
-// See vidjil-format.md
-class SampleOutputVidjil : public SampleOutput
+class SampleOutputAIRR : public SampleOutput
 {
 public:
   void out(ostream &s);

algo/tests/should-get-tests/airr-S22.should-get

+!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c clones -z 2 -3 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta  > /dev/null ; cat out/Stanford_S22.tsv
+
+$ There are four lines, all with tabs
+4:
+4:\t
+
+$ The required AIRR fields are present
+:consensus_count	
+:v_call	d_call j_call
+:sequence_id
+:sequence	
+:sequence_alignment	
+:germline_alignment
+:v_cigar	d_cigar	j_cigar	
+
+$ Three clones on IGH
+3:IGH
+
+$ One clone has 8 reads, two clones have 5 reads
+1:IGH 8
+2:IGH 5
+
+$ v_call for 2 clones (-z 2)
+2:IGHV
+
+$ First clone window appears third times (clone_id, sequence_id, sequence)
+w3:TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
+
+$ No spurious character
+0:"
+0:@
+0:\\
+

algo/tests/should-get-tests/airr-X5.should-get

+!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c clones -z 2 -2 -3 -r 1 -g $VIDJIL_DIR/germline/homo-sapiens.g ../should-vdj-tests/Demo-X5.should-vdj.fa  > /dev/null ; cat out/Demo-X5.should-vdj.tsv
+ 
+$ There are 15 = 1 + 14 lines, all with tabs
+15:
+15:\t
+
+$ All clones have 1 reads
+14: \t1\t
+
+$ 8 clones with TR recombinations, some of them having special recombinations
+2:TRA
+1:TRA[+]D
+
+2:TRB
+1:TRB[+]
+
+1:TRG
+
+3:TRD
+2:TRD[+]
+
+$ One recombination with KDE
+1:KDE
+
+$ No spurious character
+0:"
+0:@
+0:\\
+

algo/tests/should-get-tests/overlap-stdout.should-get

-!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c segment -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -A $VIDJIL_DATA/overlap-d-j.fa | grep -v web | tail -4 | tr -d '\n' | wc -c
+!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c segment -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -A $VIDJIL_DATA/overlap-d-j.fa | grep -v out | tail -4 | tr -d '\n' | wc -c
 
 $ Exported sequence has all the bases
 1:116

algo/vidjil.cpp

@@ -103,6 +103,7 @@ enum { CMD_WINDOWS, CMD_CLONES, CMD_SEGMENT, CMD_GERMLINES } ;
 #define AFFECTS_FILENAME ".affects"
 #define EDGES_FILENAME ".edges"
 #define COMP_FILENAME "comp.vidjil"
+#define AIRR_SUFFIX ".tsv"
 #define JSON_SUFFIX ".vidjil"
 
 #define DEFAULT_K      0
@@ -753,6 +754,7 @@ int main (int argc, char **argv)
   //            JSON OUTPUT              //
   /////////////////////////////////////////
 
+  string f_airr = out_dir + f_basename + AIRR_SUFFIX ;
   string f_json = out_dir + f_basename + JSON_SUFFIX ;
 
   ostringstream stream_cmdline;
@@ -1638,13 +1640,19 @@ int main (int argc, char **argv)
     cout << endl;
   }
 
+  //$ Output AIRR .tsv
+  cout << "  ==> " << f_airr << "   \t(AIRR output)" << endl;
+  ofstream out_airr(f_airr.c_str());
+  static_cast<SampleOutputAIRR *>(output) -> out(out_airr);
+
   //$ Output .vidjil json
-  cout << "  ==> " << f_json << "\t(data file for the web application)" << endl ;
+  cout << "  ==> " << f_json << "\t(data file for the Vidjil web application)" << endl ;
   ofstream out_json(f_json.c_str()) ;
   SampleOutputVidjil *outputVidjil = static_cast<SampleOutputVidjil *>(output);
 
   outputVidjil->out(out_json);
 
+
   //$$ Clean
   delete multigermline ;
   delete reads;