Nous avons procédé ce jeudi matin 08 avril 2021 à une MAJ de sécurité urgente. Nous sommes passé de la version 13.9.3 à la version 13.9.5 les releases notes correspondantes sont ici:
https://about.gitlab.com/releases/2021/03/17/security-release-gitlab-13-9-4-released/
https://about.gitlab.com/releases/2021/03/31/security-release-gitlab-13-10-1-released/

Commit fe38251e authored by Mathieu Giraud's avatar Mathieu Giraud

tests: fuse after -y/-z

parent 7113d43e
Pipeline #233694 failed with stages
in 15 minutes and 14 seconds
!REQUIRES: python $VIDJIL_DIR/tools/check_python_version.py
!OUTPUT_FILE: out/y2z0-y2z1.vidjil
!OPTIONS: --mod jR
!LAUNCH: $VIDJIL_DIR/$EXEC -b y2z0 -r1 -x3 -y2 -z0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; $VIDJIL_DIR/$EXEC -b y2z1 -r1 -x3 -y2 -z1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/fuse.py out/y2z0.vidjil out/y2z1.vidjil -o out/y2z0-y2z1.vidjil
$ Points list
2:samples.original_names
:samples.original_names[0]: data//Stanford_S22.fasta
:samples.original_names[1]: data//Stanford_S22.fasta
$ First clone (-z 1)
:clones[0].id: TGTATTACTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTAT
:clones[0]._average_read_length[0]: 233
:clones[0]._average_read_length[1]: 233
:clones[0].seg.evalue.val: 1.17e-95
:clones[0].sequence:
:clones[0].seg.5.name: IGHV1-3
$ Second clone
:clones[1].id: GCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTA
:clones[1]._average_read_length[0]: 243
:clones[1]._average_read_length[1]: 243
:clones[1].seg.evalue.val: 5.92e-97
:clones[1].sequence:
0:clones[1].seg.5.name:
$ Third clone (-y 2, no consensus)
:clones[2].id: GATAAAATTGGGTATTATGATTACGTTTGGGGGAGTTATCGTTTGGGTCT
0:clones[2]._average_read_length:
:clones[2].sequence: 0
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment