Commit fe0dd004 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: update tests, longer sequences

Some tests do not pass anymore with the -e 1e-6 threshold applied on both sides.
parent 34068e0b
......@@ -4,5 +4,5 @@ $ Segments on TRG
1: TRG .* -> .* 1
$ Computes a representative
1:clone-001.* 48 bp
1:clone-001.* 66 bp
>TRGV1*01_0//0_TRGJ1*01__TRG
NNNNNNNNNNNN
acctgggacagg
gaattattataa
tactgtgccacctgggacagg
gaattattataagaaactctt
NNNNNNNNNNNN
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment