Commit fd06ff22 authored by Mathieu Giraud's avatar Mathieu Giraud

should-get-tests/: 3 tests with not-so-easy interaction with old 'e' and new...

should-get-tests/: 3 tests with not-so-easy interaction with old 'e' and new 'b', escape some characters

Keeping in mind #3116, changing these 3 tests seems to be here a convenient way to go.
parent 1ecb80c1
......@@ -2,10 +2,10 @@
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -z 0 -w 60 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python $VIDJIL_DIR/tools/format_json.py -1
$ Points list
1:"original_names": [".*data//Stanford_S22.fasta", ".*data//Stanford_S22.fasta"]
1:"original_names": \[".*data//Stanford_S22.fasta", ".*data//Stanford_S22.fasta"\]
$ Most abundant window, twice, fused
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \\[8, 8\\].*"top": 2
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \[8, 8\].*"top": 2
# Fails since 49046ca6b97, no more 'others'
$ Windows that are not in the top 50
......
......@@ -7,13 +7,13 @@ $ From homo-sapiens.g
1:"species_taxon_id": 9606
$ Number of reads
e1:"total": [13153]
1:"total": \[13153\]
$ Number of segmented reads
e1:"segmented": [13152]
1:"segmented": \[13152\]
$ Most abundant window
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \\[8\\]
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \[8\]
$ Affect values are over all the sequence
1: "affectValues": .[^}]*"start": 1, "stop": 127
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/long-segmentation.fa
$ Sequence should be segmented by k-mer segmenter
e1:SEG_+ -> 1
b:SEG_[+] -> 1
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment