Commit fb5ae0ed authored by Mikaël Salson's avatar Mikaël Salson

Tests: Test that a VdJa sequence is segmented the same way on both strands

parent b3badeb3
!LAUNCH: ../../vidjil -i -g ../../germline/ -r 1 -c clones ../../data/revcomp-VdJa.fa
$ Just one window found
f1:==> found 1 ..-windows
$ Just one clone found
f1:==> 1 clones
$ Two reads segmented in VdJa
1:VdJa -> 2
$ segmentation for the main clone
f1:TRDV1.01 5//3 TRDD2.01 1//7 TRAJ29
>seq
ATGCAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCCTTACAGCTAGAAGATTCAGCAAAGTACTTTTGTGCTCTTGGGTCCTAAGGAAACACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
>seq-rc
GGCAAAAGCATTCTAGGTACACTGAAAAATAATTCAAGGGAAGAAGCCATTGCTGATCAAAATCAAGGATGGCTAGAAACACTTACTTGCAATCACAGAAAGTCTTGTGCCCTTTCCAAAGACAAGAGGTGTGTTTCCTTAGGACCCAAGAGCACAAAAGTACTTTGCTGAATCTTCTAGCTGTAAGGCTGAAATGGTTAAGGCGACGGATTTCGCTGCTTTCTTGAAGTTGACAGAATAGCGACCACTTTTTGCAT
\ No newline at end of file
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment