germline, add a simple test on Gallus Gallus germline

link to #3910

germline, add a simple test on Gallus Gallus germline
link to #3910
f9b86544 · Mathieu Giraud · 5b626cc6 · f9b86544
Commit f9b86544 authored May 23, 2019 by Mathieu Giraud
--- a/germline/tests/should-get-tests/gallus-gallus.should-get
+++ b/germline/tests/should-get-tests/gallus-gallus.should-get
+!NO_LAUNCHER:
+!LAUNCH: (cd $VIDJIL_DIR/germline ; cat gallus-gallus/IGHV.fa | tr '|' '#' )
+
+
+$ Found sequence of Gallus gallus Red Jungle fowl
+1: .*#IGHV1-1.01#Gallus gallus_Red Jungle fowl#
+
+$ Found sequence of Gallus gallus
+1: .*#IGHV1-21.*#Gallus gallus#
+
+$ Found a sequence part of IGHV1-1*01
+i1: tgggtgcgacaggcgcccggcaaggggctggagtgggtcgctggtattggcagcagt