Attention une mise à jour du service Gitlab va être effectuée le mardi 30 novembre entre 17h30 et 18h00. Cette mise à jour va générer une interruption du service dont nous ne maîtrisons pas complètement la durée mais qui ne devrait pas excéder quelques minutes. Cette mise à jour intermédiaire en version 14.0.12 nous permettra de rapidement pouvoir mettre à votre disposition une version plus récente.

Commit f877450e authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

Merge branch 'feature-a/2851-no-homopolymer-cost' into 'dev'

Remove default homopolymer cost

Closes #2851

See merge request !137
parents b39e2205 a6f25f14
Pipeline #11668 passed with stages
in 19 seconds
......@@ -105,8 +105,8 @@ ostream& operator<<(ostream& out, const Cost& cost)
out << "\"" << cost.match
<< ", " << cost.mismatch
<< ", " << cost.insertion
<< ", " << cost.homopolymer
<< ", " << cost.deletion_end
<< ", " << cost.homopolymer
<< "\"" ;
return out;
......
......@@ -74,8 +74,8 @@ const Cost Levenshtein = Cost(0, -1, -1);
const Cost DNA = Cost(+5, -4, -10);
// Vidjil costs
const Cost VDJ = Cost(+4, -6, -10, -1, -2);
const Cost VDJaffine = Cost(+4, -6, -15, -1, -1, -2);
const Cost VDJ = Cost(+4, -6, -10, -1);
const Cost VDJaffine = Cost(+4, -6, -15, -1, -1, MINUS_INF);
const Cost IdentityDirty = Cost(+1000, -1, -1); // pour avoir une estimation de longueur de l'alignement, utilise dans compare-all
const Cost Cluster = Cost(+1, -4, -4, 0, 0);
......
!LAUNCH: $VIDJIL_DIR/algo/tools/align -m 6 -i 0 -j 1 $VIDJIL_DATA/msa.fa
$ Default cost and parameters
1: (4, -6/-10/-10, -9999-9999/-9999-9999, -1, -2)
1: (4, -6/-10/-10, -9999-9999/-9999-9999, -1, -10)
1: 0.05/0.34
$ Global alignment
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -f '1, 2, 3, 4, 5'
!EXIT_CODE: 1
$Check that correct custom cost is used
1:use custom Cost "1, 2, 3, 4, 5"
......@@ -4,7 +4,7 @@ $ License
1:Vidjil is free software
$ Check default costs
1:segmenter .* "4, -6, -10, -2, -1"
1:segmenter .* "4, -6, -10, -1, -10"
1:clustering .* "1, -4, -4, 0, 0"
>TRBV6-1*01 3/5/2 TRBJ2-7*01 [TRB] {CASKVSP!YEQYF}
# read: GTGTACTTCTGTGCCAGCAAGGTGAGTCCCCCTACGAGCAG
# ||||||||||||||||||| |||||||||||
# TRBV6-1*01 GTGTACTTCTGTGCCAGCAGTGAAGC |||||||||||
# TRBJ2-7*01 CTCCTACGAGCAGTACTTCGGGCCGG
>TRBV6-1*01 7/AGGTGAGTCCC/2 TRBJ2-7*01 [TRB] {CASKVSP!YEQYF}
GAGGGTACCACTGACAAAGGAGAAGTCCCCAATGGCTACAATGTCTCCAGATTAAACAAACGGGAGTTCTCGCTCAGGCTGGAGTCGGCTGCTCCCTCCCAGACATCTGTGTACTTCTGTGCCAGCAAGGTGAGTCCCCCTACGAGCAGTACTTCGGGCCGG
# AGC commun aux deux segments
>TRBV7-2*02 0/0/3 TRBJ2-3*01 [TRB] {CASSFSTDTQYF}
# read: GTGTATCTCTGTGCCAGCAGCTTTAGCACAGATACGCAGTATTTTGGCCC
# ||||||||||||||||||||||| |||
# TRBV7-2*02 GTGTATCTCTGTGCCAGCAGCTT-AGC
# |||||||||||||||||
# TRBJ2-3*01 AGCACAGATACGCAGTATTT
# ou |||||||||||||||||||||||
# TRBV7-2*02 GTGTATCTCTGTGCCAGCAGCTTAGC
# ||||||||||||||||||||
# TRBJ2-3*01 AGCACAGATACGCAGTATTT
>TRBV7-2*02 (3/T/0, 0//3) TRBJ2-3*01 [TRB] {CASSFSTDTQYF} BUG
TTACCCTTTACTGGTACCGGCAGAGGCTGGGGCAGGGCCTGGAGTTTTTAATTTACTTCCAAGGCAACAGTGCACCAGACAAATCAGGGCTGCCCAGTGATCGCTTCTCTGCAGAGAGGACTGGGGAATCCGTCTCCACTCTGACGATCCAGCGCACACAGCAGGAGGACTCGGCCGTGTATCTCTGTGCCAGCAGCTTTAGCACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGGTAAGCGGG
>TRBV11-2*01 1/4/0 TRBJ2-7*01 [TRB] {CASSLGPSYEQYF}
......
# 0000-nck-TRB.should-vdj.fa.rc
>TRBV7-2*02 0/0/3 TRBJ2-3*01 [TRB]
>TRBV7-2*02 3/T/0 TRBJ2-3*01 [TRB] BUG
CCCGCTTACCGAGCACTGTCAGCCGGGTGCCTGGGCCAAAATACTGCGTATCTGTGCTAAAGCTGCTGGCACAGAGATACACGGCCGAGTCCTCCTGCTGTGTGCGCTGGATCGTCAGAGTGGAGACGGATTCCCCAGTCCTCTCTGCAGAGAAGCGATCACTGGGCAGCCCTGATTTGTCTGGTGCACTGTTGCCTTGGAAGTAAATTAAAAACTCCAGGCCCTGCCCCAGCCTCTGCCGGTACCAGTAAAGGGTAA
# 0119-lil-IGK+-TRA+D-TRD+-TRG.should-vdj.fa.rc
......
......@@ -152,11 +152,11 @@ GCGGGATCCTTCGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGT
AGCTCTGCTGATTTGTGGGCACTTATGAACCCGAAAGGACATGGCCATGGGGTGGGTAGGGACATAGGGACAGATGCCAGCCTGAGGTGGAGCCTCAGGACACAGGTGGGCACGGACACTATCCACATAAGCGAGGGATAGACCCGAGTGTCCCCACAGCAGACCTGAGAGCGCTGGGCCCACAGCCTCCCCTCAGAGCCCTGCTGCCTCCTCCGGTCAGCCCTGGACATCCCAGGTTTCCCCAGGCCTGCCGGTAGGTTTAGAATGAGGTCTGTGTCACTGTGGTATTACGATATTTTGACTGGTTATTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTA
#1349 vh3
>IGHV3-23*01 1/15/5 IGHD3-10*01 0/2/0 IGHJ3*02 [IGH] BUG
>IGHV3-23*01 1/15/5 IGHD3-10*01 0/2/0 IGHJ3*02 [IGH]
CGCCCCACTTGATATTCCTTTTAGCCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAAGGGTGGGAGGTATTAAACTATGGTTCGGGGAGTTATTATAACGTTGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAGGTAACTC
#1347 vh2
>IGHV2-26*01 0/5/5 IGHD5-24*01 4/13/7 IGHJ4*02 [IGH] BUG
>IGHV2-26*01 0/5/5 IGHD5-24*01 4/13/7 IGHJ4*02 [IGH]
TCAGAGACCTCACGCTGACCTGCACCGTCTCTGGGTTCTCACTCAGCAATGCTAGAATGGGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACACATTTTTTCGAATGACAAAAAATCCTACAGCACATCTCTGAAGAGCAGGCTCACCATCTCCAAGGACACCTCCAAAAGCCAGGTGGTCCTTACCATGACCAATATGGACCCTGTGGACACAGCCACATATTACTGTGCATGGATACCCGAGGATGGCTACAACGACAAGAGCCAATGACTACTGGGGCCAGGGAACGCTGGTCACCGTCTCCTCAGGTAAATCCATGCACAGTAATATGTGGCTGTGTCCACAGGGTCCATATTGGTCATGGTAAGGACCACCTGGCTTTTGGAGGTGTCCTTGGAGA
#1339 vh3
......
......@@ -216,7 +216,7 @@ void usage(char *progname, bool advanced)
if (advanced)
cerr << "Fine segmentation options (second pass)" << endl
<< " -f <string> use custom Cost for fine segmenter : format \"match, subst, indels, homo, del_end\" (default "<< DEFAULT_SEGMENT_COST <<" )"<< endl
<< " -f <string> use custom Cost for fine segmenter : format \"match, subst, indels, del_end, homo\" (default "<< DEFAULT_SEGMENT_COST <<" )"<< endl
<< " -E <float> maximal e-value for determining if a D segment can be trusted (default: " << THRESHOLD_NB_EXPECTED_D << ")" << endl
<< endl ;
......@@ -231,7 +231,7 @@ void usage(char *progname, bool advanced)
<< " -N <int> minimum required neighbors for automatic clustering (default " << DEFAULT_MINPTS << ")" << endl
<< " -S generate and save comparative matrix for clustering" << endl
<< " -L load comparative matrix for clustering" << endl
<< " -C <string> use custom Cost for automatic clustering : format \"match, subst, indels, homo, del_end\" (default "<< DEFAULT_CLUSTER_COST <<" )"<< endl
<< " -C <string> use custom Cost for automatic clustering : format \"match, subst, indels, del_end, homo\" (default "<< DEFAULT_CLUSTER_COST <<" )"<< endl
<< endl ;
cerr << "Detailed output per read (generally not recommended, large files, but may be used for filtering, as in -uu -X 1000)" << endl
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment