Commit f7bdde36 authored by Mikaël Salson's avatar Mikaël Salson
Browse files

stanford-fuse.should_get: Don't fail tests.

    Tests were failed because fuse.py was not packaged with the release.
    This is not the case anymore. So the tests can be un-failed.
parent 90c34f70
!LAUNCH: ../../vidjil -G ../../germline/IGH ../../data/Stanford_S22.fasta ; python ../../tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | sh format-json.sh !LAUNCH: ../../vidjil -G ../../germline/IGH ../../data/Stanford_S22.fasta ; python ../../tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | sh format-json.sh
$ Points list $ Points list
f1:"point": [ "", "" ] 1:"point": [ "", "" ]
$ Most abundant window, twice, fused $ Most abundant window, twice, fused
f1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC", .*"reads": [ 8, 8 ] 1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC", .*"reads": [ 8, 8 ]
# Fails since 49046ca6b97, no more 'others' # Fails since 49046ca6b97, no more 'others'
$ Windows that are not in the top 50 $ Windows that are not in the top 50
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment