Nous avons procédé ce jeudi matin 08 avril 2021 à une MAJ de sécurité urgente. Nous sommes passé de la version 13.9.3 à la version 13.9.5 les releases notes correspondantes sont ici:
https://about.gitlab.com/releases/2021/03/17/security-release-gitlab-13-9-4-released/
https://about.gitlab.com/releases/2021/03/31/security-release-gitlab-13-10-1-released/

Commit f587fa97 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: no, fuse do not complete 'seg' fields when the 'top' is not better

We are still amazed by this, but this works.
see #3970
parent fe38251e
Pipeline #233709 passed with stages
in 45 minutes and 51 seconds
......@@ -16,7 +16,8 @@ $ First clone (-z 1)
:clones[0]._average_read_length[1]: 233
:clones[0].seg.evalue.val: 1.17e-95
:clones[0].sequence:
:clones[0].seg.5.name: IGHV1-3
# See #3970 and !784: now fuse keeps the best 'top' or otherwise the first sequence
f:clones[0].seg.5.name: IGHV1-3
$ Second clone
:clones[1].id: GCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTA
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment