tests: no, fuse do not complete 'seg' fields when the 'top' is not better

We are still amazed by this, but this works. see #3970

tests: no, fuse do not complete 'seg' fields when the 'top' is not better
We are still amazed by this, but this works. see #3970
f587fa97 · Mathieu Giraud · fe38251e · f587fa97
Commit f587fa97 authored Apr 06, 2021 by Mathieu Giraud
--- a/algo/tests/should-get-tests/algo-then-fuse-y-z.should
+++ b/algo/tests/should-get-tests/algo-then-fuse-y-z.should
@@ -16,7 +16,8 @@ $ First clone (-z 1)
 :clones[0]._average_read_length[1]: 233
 :clones[0].seg.evalue.val: 1.17e-95
 :clones[0].sequence:
-:clones[0].seg.5.name: IGHV1-3
+# See #3970 and !784: now fuse keeps the best 'top' or otherwise the first sequence
+f:clones[0].seg.5.name: IGHV1-3

 $ Second clone
 :clones[1].id: GCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTA