Commit f4711480 authored by THONIER Florian's avatar THONIER Florian
Browse files

Algo: Add a test on a sequence that should be seen as only V

parent 53d929df
Pipeline #744660 waiting for manual action with stages
in 22 minutes
# This germline sequence is seen as `IGK V2D-29 /78/ J4` instead of `IGLV2` with 242 nt of match (100%).
# _________________________KKK?KKK____________K__________________K__K_____________K____________________________________________________kkkkkkkk_kk______________________________K___________________________________________________________________
>IGLV2
ATGTGGACTCCCTCATGAGCAGATGCCACCAGGGCCACTGGCCCCAGCTTCCTCCTTCACAGCTGCAGTGGGGGCTGGGGCTGGGGCATCCCAGGGAGGGTTTTTGTATGAGCCTGTGTCACAGTGTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTGAGTCTCTTCTCCCCTCTCCTTCCCCGCTCTTGGGACAATTTCTGCTGTTTTTGTTTGTTTCTGTATCTTGTCTCA
!LAUNCH: $VIDJIL_DIR/$EXEC --all -g $VIDJIL_DIR/germline/homo-sapiens.g $VIDJIL_DATA/5116-nan-only-v-germline.fasta
$ Segment only 2 reads, because we do not look for incomplete recombinations
0:junction detected in 1 reads
$ Sequence seen a germline only
1:UNSEG only V/5' .*-> .* 1
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment