Commit f27abbf4 authored by Marc Duez's avatar Marc Duez
Browse files

watir : test file

parent 6012db3e
{
"germlines": {
"custom": {
"3": [],
"5": [],
"4": [],
"shortcut": "X"
}
},
"timestamp": [
"2014-12-04 15:30:05"
],
"reads-distribution-1000": [
0
],
"vidjil_json_version": "2014.10",
"reads-distribution-1": [
22430
],
"reads": {
"segmented": [
742377
],
"total": [
786861
],
"germline": {
"TRA": [
1415
],
"TRB": [
716036
],
"TRD": [
22239
],
"TRG": [
521
],
"IGL": [
34
],
"IGK": [
509
],
"IGH": [
1632
]
}
},
"samples": {
"commandline": [
"/home/vidjil//vidjil -o /mnt/result/tmp/out-000653/ -b 000653 -g germline/mus-musculus/ /mnt/upload/uploads/sequence_file.data_file.8e82b58dd8f6ccd0.5754322e66712e617373656d626c65642e66617374712e677a.gz "
],
"number": 1,
"original_names": [
"helloworld"
],
"log": [
" ==> segmented 742386 reads (94.3%)\n ==> found 318962 40-windows in 742377 segments (94.3%) inside 786861 sequences\n # av. length\n TRG -> 521 166.0\n IGH -> 1632 174.6\n TRD -> 22239 173.1\n IGK -> 509 163.7\n TRA -> 1415 174.3\n TRB -> 716036 176.6\n IGL -> 34 192.5\n\n ? -> 0\n SEG_+ -> 233333 178.8\n SEG_- -> 509053 175.4\n UNSEG too short -> 0\n UNSEG strand -> 7588 221.8\n UNSEG too few (zero) -> 19482 174.2\n UNSEG too few V -> 2012 182.6\n UNSEG too few J -> 14993 202.1\n UNSEG < delta_min -> 0\n UNSEG > delta_max -> 385 197.4\n UNSEG ambiguous -> 15 208.6\n\n = SEG, with window -> 742377 176.5\n = SEG, but no window -> 9 131.7\n"
]
},
"reads-distribution-10": [
159715
],
"clones": [
{
"germline": "TRB",
"sequence": 0,
"top": 90,
"seg_stat": [
{
"1": 143,
"2": 168
}
],
"reads": [
311
],
"id": "YCCYTGTGCYGYGYCCCYYTGCTYGYGTYT"
},
{
"germline": "TRB",
"name": "TRBV29*01 -2/3/-2 TRBD2*01 -2/3/-5 TRBJ2-7*01",
"sequence": "GYTTYYCCTYTYTGYTYTGCYAAAYAACYYYYTGTGYCTYTGTGCYGYGTTYGYYCTGGGGGYAYTYAYGYCTYGGYCCGGYCYGGCYACGGTTTYYGYYTYYAATGTYCYYCCYAG",
"top": 7,
"seg": {
"5end": 69,
"4end": 82,
"5start": 0,
"3": "TRBJ2-7*01",
"5": "TRBV29*01",
"4": "TRBD2*01",
"4start": 73,
"3start": 86
},
"reads": [
606
],
"seg_stat": [
{
"1": 217,
"2": 389
}
],
"id": "TGCYGYGTTYGYYCTGGGGGYAYTYAYGYC"
},
{
"germline": "TRB",
"sequence": 0,
"top": 97,
"seg_stat": [
{
"1": 134,
"2": 169
}
],
"reads": [
303
],
"id": "YTGTGCYGYGYCCCYYGGYYAAAYCCTTGY"
},
{
"germline": "TRB",
"sequence": 0,
"top": 50,
"seg_stat": [
{
"1": 132,
"2": 230
}
],
"reads": [
362
],
"id": "CTGTGCYGYGYYCTGGGGGGTYCYTYAYGYC"
},
{
"germline": "TRB",
"sequence": 0,
"top": 72,
"seg_stat": [
{
"1": 116,
"2": 216
}
],
"reads": [
332
],
"id": "CTGYCCTGYGTGYYYGGGGYAAAAYCCTTGYC"
},
{
"germline": "TRB",
"sequence": 0,
"top": 28,
"seg_stat": [
{
"1": 151,
"2": 281
}
],
"reads": [
432
],
"id": "GYCTYTGTGCYGYGYCYYYAGYTYTTTGGT"
},
{
"germline": "TRB",
"name": "TRBV29*01 -5/4/-0 TRBD2*01 -0/4/-1 TRBJ2-3*01",
"sequence": "GYTTYYCCTYTYTGYTYTGCYAAAYAACYYYYTGTGYCTYTGTGCYGYGYCCCGGYCTGGGGGGGCGCGGGTGYYAACGCTGYTTTTGGCYAGYACYYCTYCTGTYYYGYYTYYAATGTYCYYCCYAG",
"top": 11,
"seg": {
"5end": 66,
"4end": 84,
"5start": 0,
"3": "TRBJ2-3*01",
"5": "TRBV29*01",
"4": "TRBD2*01",
"4start": 71,
"3start": 89
},
"reads": [
532
],
"seg_stat": [
{
"1": 196,
"2": 336
}
],
"id": "GCYGYGYCCCGGYCTGGGGGGGCGCGGGTGYYAA"
},
{
"germline": "TRB",
"sequence": 0,
"top": 34,
"seg_stat": [
{
"1": 159,
"2": 256
}
],
"reads": [
415
],
"id": "TGYCTGYCCTGYGTGCCGYAAYYYAGYTYTT"
},
{
"germline": "TRB",
"sequence": 0,
"top": 55,
"seg_stat": [
{
"1": 138,
"2": 216
}
],
"reads": [
354
],
"id": "GTGCYGYGTTYTGYYAGGGGGYYCCYGYCTT"
},
{
"germline": "TRB",
"sequence": 0,
"top": 25,
"seg_stat": [
{
"1": 144,
"2": 302
}
],
"reads": [
446
],
"id": "CTYTGTGCYGYGYCGGYGGCYCYCYYCCTY"
},
{
"germline": "TRB",
"sequence": 0,
"top": 38,
"seg_stat": [
{
"1": 179,
"2": 231
}
],
"reads": [
410
],
"id": "ACCYTGTGCYGYGYCGGYYCYAYYCCYGY"
},
{
"germline": "TRB",
"sequence": 0,
"top": 22,
"seg_stat": [
{
"1": 155,
"2": 302
}
],
"reads": [
457
],
"id": "TYTGTGCYGYGTTYAAYGYACYTGCTYGYGT"
},
{
"germline": "TRB",
"sequence": 0,
"top": 61,
"seg_stat": [
{
"1": 150,
"2": 198
}
],
"reads": [
348
],
"id": "TGTGCYGYGCCCCGGYYGGGGGGGYYYCCYGT"
},
{
"germline": "TRB",
"name": "TRBV26*01 -4/1/-2 TRBD1*01 -6/2/-0 TRBJ2-1*01",
"sequence": "CCTTGYGCCYYAATYAGYCYTYGGYGYYCYAGYCTGYCCYTGTGCYGYGYCYYCTYACYTGCTYGYGTYTYGYCYGGYYCYCYACCGYCYYGYYTYYAATGTYCYYCCYAG",
"top": 17,
"seg": {
"5end": 66,
"4end": 71,
"5start": 0,
"3": "TRBJ2-1*01",
"5": "TRBV26*01",
"4": "TRBD1*01",
"4start": 68,
"3start": 74
},
"reads": [
471
],
"seg_stat": [
{
"1": 190,
"2": 281
}
],
"id": "CCYTGTGCYGYGYCYYCTYACYTGCTYGYG"
},
{
"germline": "TRB",
"sequence": 0,
"top": 43,
"seg_stat": [
{
"1": 169,
"2": 211
}
],
"reads": [
380
],
"id": "CYTGTGCYGYGYTYYGYAACYTGCTYGYGT"
},
{
"germline": "TRB",
"sequence": 0,
"top": 27,
"seg_stat": [
{
"1": 185,
"2": 252
}
],
"reads": [
437
],
"id": "YTGTGCYGYGYCGGYYGGGGGCTYGYGTYTT"
},
{
"germline": "TRB",
"sequence": 0,
"top": 82,
"seg_stat": [
{
"1": 122,
"2": 201
}
],
"reads": [
323
],
"id": "GYCCTGYGTGYCCCCGGYYGGYYCCTTGYCTT"
},
{
"germline": "TRD",
"name": "TRDV1*01 -9/10/-3 TRDD2*01 -7/19/-17 TRDJ1*01",
"sequence": "CCTTGYGCCYYAATYAGYCYTYGGYGYYCYAGYCTGYCCYTGTGCYGYGYTGYGGGGGYGYAAYCGCYYTTTTGYYAGYAGCCGGCYATTGTTGYYGYYTYYAATGTYCYYCCYAG",
"top": 13,
"seg": {
"5end": 57,
"4end": 73,
"5start": 0,
"3": "TRDJ1*01",
"5": "TRDV1*01",
"4": "TRDD2*01",
"4start": 68,
"3start": 93
},
"reads": [
500
],
"seg_stat": [
{
"1": 245,
"2": 255
}
],
"id": "GYCCYTGTGCYGYGYTGYGGGGGYGYAAYCG"
},
{
"germline": "TRB",
"sequence": 0,
"top": 45,
"seg_stat": [
{
"1": 118,
"2": 256
}
],
"reads": [
374
],
"id": "CTGTGCYGYGTTYCCTGGGGCTYTYAYGYCTY"
},
{
"germline": "TRB",
"sequence": 0,
"top": 75,
"seg_stat": [
{
"1": 127,
"2": 203
}
],
"reads": [
330
],
"id": "CTGTGCYGYGYGYCTGGGGGTGGYCCGGGYGCY"
},
{
"germline": "TRB",
"sequence": 0,
"top": 51,
"seg_stat": [
{
"1": 163,
"2": 198
}
],
"reads": [
361
],
"id": "YTGTGCYGYGYTGYYGGGYAAYYYAGYTT"
},
{
"germline": "TRB",
"sequence": 0,
"top": 91,
"seg_stat": [
{
"1": 119,
"2": 192
}
],
"reads": [
311
],
"id": "CYTGTGCYGYGCCYYGGGTTTTYYACYAAYT"
},
{
"germline": "TRB",
"sequence": 0,
"top": 93,
"seg_stat": [
{
"1": 151,
"2": 159
}
],
"reads": [
310
],
"id": "CTGTGCYGYGYTGGYTGGYGYAAAYCCTTGYC"
},
{
"germline": "TRB",
"sequence": 0,
"top": 48,
"seg_stat": [
{
"1": 167,
"2": 199
}
],
"reads": [
366
],
"id": "ACTYTGTGCYGYGTYCYAAACYTGCTYGYGTT"
},
{
"germline": "TRB",
"sequence": 0,
"top": 21,
"seg_stat": [
{
"1": 229,
"2": 233
}
],
"reads": [
462
],
"id": "ACCYTGTGCYGYGYTGYYYYAGYTYTTTGG"
},
{
"germline": "TRB",
"name": "TRBV29*01 -1/0/-0 TRBD1*01 -2/0/-5 TRBJ2-5*01",
"sequence": "TACAGGGTCTCACGGAAGAAGCGGGAGCATTTCTCCCTGATTCTGGATTCTGCTAAAACAAACCAGACATCTGTGTACTTCTGTGCTAGCAGTTTATGGGACAGGGGAGACACCCAGTACTTTGGGCCAGGCACTCGGCTCCTCGTGTTAGAGGATCTGAGAAATGTGACTCCACCCAAG",
"top": 1,
"seg": {
"5end": 96,
"4end": 106,
"5start": 0,
"3": "TRBJ2-5*01",
"5": "TRBV29*01",
"4": "TRBD1*01",
"4start": 97,
"3start": 107
},
"reads": [
962
],
"seg_stat": [
{
"1": 382,
"2": 580
}
],
"id": "TGTGCTAGCAGTTTATGGGACAGGGGAGACACCCAGTACT"
},
{
"germline": "TRB",
"name": "TRBV29*01 -5/5/-0 TRBD2*01 -3/2/-6 TRBJ2-5*01",
"sequence": "YYGGGYYACGYAYAGCGGYGYTTYYCCTYTYTGYTYTGCYAAAYAACYYYYTGTGYCTYTGTGCYGYGTYCCCGGYCTGGGGGTGYYCCYGYCTTTGGGCYGGYCYGGCYCYGTGTYYGYYTYYAATGTYCYYCCYAG",
"top": 14,
"seg": {
"5end": 92,
"4end": 108,
"5start": 0,
"3": "TRBJ2-5*01",
"5": "TRBV29*01",
"4": "TRBD2*01",
"4start": 98,
"3start": 111
},
"reads": [
497
],
"seg_stat": [
{
"1": 166,
"2": 331
}
],
"id": "TGTGCYGYGTYCCCGGYCTGGGGGTGYYCCYGT"
},
{
"germline": "TRB",
"sequence": 0,
"top": 67,
"seg_stat": [
{
"1": 123,
"2": 217
}
],
"reads": [
340
],
"id": "CTGYCCTGYGTGYGTGGYYAYTYAYGYCTY"
},
{
"germline": "TRB",
"sequence": 0,
"top": 76,
"seg_stat": [
{
"1": 130,
"2": 198
}
],
"reads": [
328
],
"id": "TYTGTGCYGYGYCCCGGYYAAYYCCYGYCT"
},
{
"germline": "TRB",
"sequence": 0,
"top": 53,
"seg_stat": [
{
"1": 115,
"2": 243
}
],
"reads": [
358
],
"id": "ACTGYCCTGYGTGYYGGGCYCYTYAYGYCTT"
},
{
"germline": "TRB",
"sequence": 0,
"top": 98,
"seg_stat": [
{
"1": 126,
"2": 176
}
],
"reads": [
302
],
"id": "TYTGTGCYGYGTGGGGGGYCCCCYGYCTTTGGGC"
},
{
"germline": "TRB",
"sequence": 0,
"top": 79,
"seg_stat": [
{
"1": 104,
"2": 221
}
],
"reads": [
325
],
"id": "CTTTGTGYAGYGCTYYYGYAAAAYCCTTGYCT"
},
{
"germline": "TRB",
"name": "TRBV26*01 -4/0/-4 TRBD1*01 -5/5/-0 TRBJ1-4*02",
"sequence": "CCTTGYGCCYYAATYAGYCYTYGGYGYYCYAGYCTGYCCYTGTGCYGYGYAYTTYYACYAAYTYTTTTYGGYATGYACYAGCTGYTGYCTGYGYYTYYAATGTYCYYCCYAG",
"top": 5,
"seg": {
"5end": 66,
"4end": 64,
"5start": 0,
"3": "TRBJ1-4*02",
"5": "TRBV26*01",
"4": "TRBD1*01",
"4start": 67,
"3start": 70
},
"reads": [
644
],
"seg_stat": [
{
"1": 232,
"2": 412
}
],
"id": "YCCYTGTGCYGYGYAYTTYYACYAAYTYT"
},
{
"germline": "TRB",
"sequence": 0,
"top": 92,
"seg_stat": [
{
"1": 119,
"2": 191
}
],
"reads": [
310
],
"id": "GYCTGYCCTGYGTGYGTYACYAYYCCYGYC"
},
{
"germline": "TRB",
"sequence": 0,
"top": 99,
"seg_stat": [
{