MAJ terminée. Nous sommes passés en version 14.6.2 . Pour consulter les "releases notes" associées c'est ici :

Commit f121678c authored by Thonier Florian's avatar Thonier Florian Committed by Mathieu Giraud
Browse files

index.html, js/model.js: primers fictifs

parent 24ba0209
......@@ -217,6 +217,7 @@
<div class="menu_box">
primer set</br>
<div class="buttonSelector" onclick="m.switchPrimersSet('biomed2')"><input type="radio" id="primerBiomed2" name="primers" value="biomed2" /><label for="primerBiomed2">biomed2</label></div>
<div class="buttonSelector" onclick="m.switchPrimersSet('primer_fictif')"><input type="radio" id="primer_fictif" name="primers" value="primer_fictif" /><label for="primer_fictif">primer_fictif</label></div>
<!-- TODO : construire liste à partir des data disponibles/chargées dans le model.
TODO : passer ça en liste deroulante ? -->
......@@ -2398,6 +2398,12 @@ changeCloneNotation: function(cloneNotationType) {
this.primersSetData["biomed2"]["IGH"]["primer3"] = ["CCAGTGGCAGAGGAGTCCATTC", "GTCACCGTCTCCTCAGGTA"]; // GTCACCGTCTCCTCAGGTA is a consensus sequence use because official one (CCAGTGGCAGAGGAGTCCATTC) doesn't work properly
// test fictif; sequence inclut dans les sequences de clones
this.primersSetData["primer_fictif"]["TRD"] = {};
this.primersSetData["primer_fictif"]["TRD"]["primer5"] = ["GATTTTACTCAAGGACGGTT", "GCAAAGAACCTGGCTGT", "AGATTTTACTCAAGGAC"] // V3, V2,
this.primersSetData["primer_fictif"]["TRD"]["primer3"] = ["AGGAACCCGTGTGACT", "GAACACAACTCATCGTGGA", "GAACTGGCATCAAACTCTTC"] // J1, J2, J3
// Test qunits
this.primersSetData["primer_test"]["IGH"] = {};
this.primersSetData["primer_test"]["IGH"]["primer5"] = [] // IGH seq from model_test.js
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment