Commit f081f16f authored by Mathieu Giraud's avatar Mathieu Giraud

should-vdj: BRI_*, fix locus tags

parent 61e52780
......@@ -177,7 +177,7 @@ TTTCTCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAGCCCTATAGTGAGTCGTATTA
#target 0956LC
>IGHV6-1*01 5/TCCCGATCGAGG/-6 IGHD3-10*01 -0/AACCT/-4 IGHJ6*02
>IGHV6-1*01 5/TCCCGATCGAGG/-6 IGHD3-10*01 -0/AACCT/-4 IGHJ6*02 [IGH]
GTAAAACGACGGCCAGTGTACAGCTGCAGCAGTCAGGTCCAGGACTGGTGAAGCCCTCGCAGACCCTCTCAC
TCACCTGTGCCATCTCCGGGGAC
AGTGTCTCTAGCAACAGTGCTGCTTGGAACTGGATCAGGCAGTCCCCATCGAGAGGCCTTGAGTGGCTGGGA
......@@ -192,7 +192,7 @@ AGCCCTATAGTGAGTCGTATTA
#target 0969JS
>IGHV5-51*03 0/TTGAGAAGGGTTTTT/5 IGHD6-13*01 2/CCC/6 IGHJ4*02
>IGHV5-51*03 0/TTGAGAAGGGTTTTT/5 IGHD6-13*01 2/CCC/6 IGHJ4*02 [IGH]
GTAAAACGACGGCCAGTAGGTGCAGCTGGTGGAGTCTGGAGCAGAGGTGAAAAAGCCGGGGGAGTCTCTGAAG
ATCTCCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAA
GGCCTGGAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAG
......@@ -218,7 +218,7 @@ TTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT
#target 0990CE
>IGHV3-30*18 4/AAGATTCACCATA/21 IGHD32-21*01 0/GTCGGCCCC/2 IGHD3-22*01 7/CGC/10 IGHJ4*02 [IGH]
>IGHV3-30*18 4/AAGATTCACCATA/21 IGHD32-21*01 0/GTCGGCCCC/2 IGHD3-22*01 7/CGC/10 IGHJ4*02 [IGH+]
TGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCT
TCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCAT
ATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGA
......
#target 0728LH
>IGKV3-15*01 0/GGGACCGACCGACG/9 KDE [IGK]
>IGKV3-15*01 0/GGGACCGACCGACG/9 KDE [IGK+]
GGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAG
TTTATTACTGTCAGCAGTATAATAACTGGCCTCC
GGGACCGACCGACG
......@@ -10,7 +10,7 @@ GTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 0732EC
#15//0 is too permissive
>IGKV2D-30*01 17/AG/0 KDE [IGK] BUG
>IGKV2D-30*01 17/AG/0 KDE [IGK+] BUG
ACAGTGATGGAACACCTACTTGAATTGGTTTCAGCAGAGGCCAGGCCAATCTCCAAGGCGCCTAATTTATAA
GGTTTCTAACTGGGACTCTGGGGTCCCAGACA
GATTCAGCGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGG
......@@ -20,7 +20,7 @@ TGACCTCTGAGGACCTGTCTGTAAACGTCCAGAGAAAAGCATGTGCCTGAAGGGTCTATGAAGGGA
#target 0732EC
>Intron 2/GA/2 KDE [IGK]
>Intron 2/GA/2 KDE [IGK+]
ATAATTGCATTTTTTAATGACCGTGGGTCTGTGAAAAAAATAGGAAATATTTTAAAGAGTATGTTCTTTCAT
TATCCTCTGTTATTACTTGTCTACATTTTTATTCTGCCAAGAAGGCCGTGGCACCGCGAGCTGTAGACAGAG
CCGCGGTCTTTCTCGATTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTA
......@@ -31,13 +31,13 @@ ATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTC
#target 0862PT
#end of IGKV2-30*01/15 is ...aaggTac
>IGKV2-30*01 (12//15, 15/CAC/15) KDE [IGK]
>IGKV2-30*01 (12//15, 15/CAC/15) KDE [IGK+]
GATTCAGTGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGG
TTTATTACTGCATGCAAGGCACGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 0931JS
>IGKV3-15*01 0/CCTTGGACCCC/0 KDE [IGK]
>IGKV3-15*01 0/CCTTGGACCCC/0 KDE [IGK+]
GGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGA
AGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCC
CCTTGGACCCC
......@@ -45,7 +45,7 @@ GGAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 0931JS
>Intron 2/AGGGGGT/4 KDE [IGK]
>Intron 2/AGGGGGT/4 KDE [IGK+]
TTTTTTTTTTTTTTTTTTTTTTTCAAGCAGAAGACGGCATACGAGATCGAAGGACGTGACTGGAGTTCAGAC
GTGTGCTCTTCCGATCTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAG
TGGCCGTGGCCACCCTGTGTCTGCCCGATTAATGCTGCCGTAGCCAGCTTTCCTGA
......@@ -54,7 +54,7 @@ CCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 0990CE
>IGKV4-1*01 0/CCACAAAT/16 KDE [IGK]
>IGKV4-1*01 0/CCACAAAT/16 KDE [IGK+]
CGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGG
CAGTTTATTACTGTCAGCAATATTATAGTACTCCCCC
CCACAAAT
......@@ -62,7 +62,7 @@ CCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1012SP
>IGKV3-15*01 4/TTTACAGGGCTTCAC/0 KDE [IGK]
>IGKV3-15*01 4/TTTACAGGGCTTCAC/0 KDE [IGK+]
GGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAG
TTTATTACTGTCAGCAGTATAATAACTGGC
TTTACAGGGCTTCAC
......@@ -70,14 +70,14 @@ GGAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1025TT
>IGKV2-24*01 0/TGT/19 KDE [IGK]
>IGKV2-24*01 0/TGT/19 KDE [IGK+]
GATTCAGTGGCAGTGGGGCAGGGACAGATTTCACACTGAAAATCAGCAGGGTGGAAGCTGAGGATGTCGGGG
TTTATTACTGCATGCAAGCTACACAATTTCCTCATGTAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1026TM
#start of KDE/2 is agCcct...
>IGKV1-39*01 (1/GCGCCTTCTCC/2, 1/GCGCCTTCTCCAGG/5) KDE [IGK]
>IGKV1-39*01 (1/GCGCCTTCTCC/2, 1/GCGCCTTCTCCAGG/5) KDE [IGK+]
AGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCA
ACTTACTACTGTCAACAGAGTTACAGTACCCCTC
GCGCCTTCTCCAGG
......@@ -85,7 +85,7 @@ CCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1026TM
>Intron 2/C/0 KDE [IGK]
>Intron 2/C/0 KDE [IGK+]
TTTTTTTTTTTTTTTTTTTTTTTTTCAAGCAGAAGACGGCATACGAGATCACCGCTTGTGACTGGAGTTCAG
ACGTGTGCTCTTCCGATC
TGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCT
......@@ -95,14 +95,14 @@ GGAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1089IH
#8/ACT/1 is too permissive
>IGKV2-30*01 8/ACTGAGG/5 KDE [IGK] BUG
>IGKV2-30*01 8/ACTGAGG/5 KDE [IGK+] BUG
GATTCAGTGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGG
TTTATTACTGCATGCAAGGTACACACACTGAGGCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAG
CTGC
#target 1163SC
>Intron 5/CCGTCATCC/1 KDE [IGK]
>Intron 5/CCGTCATCC/1 KDE [IGK+]
TTTTTTTTTTTTTTTTTTTTTCAAGCAGAAGACGGCATACGAGATGCTACTAGGTGACTGGAGTTCAGACGT
GTGCTCTTCCGATCTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTG
GCCGTGGCCACCCTGTGTCTGCCCGATTGATGCTGCCGTAGCCAGCTTTCC
......@@ -112,7 +112,7 @@ GAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1200CT
#end of IGKV1-17*10 is ...tacccTcc
>IGKV1-17*01 (0//16, 3/CCC/16) KDE [IGK]
>IGKV1-17*01 (0//16, 3/CCC/16) KDE [IGK+]
GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACAATCAGCAGCCTGCAGCCT
GAAGATTTTGCAACTTATTACTGTCTACAGCATAATAGTTACCC
CCC
......@@ -120,7 +120,7 @@ CCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1203LL
>IGKV1-33*01 0/GCC/1 KDE [IGK]
>IGKV1-33*01 0/GCC/1 KDE [IGK+]
GGGGTCCCATCAAGGTTCAGTGGAAGTGGATCTGGGACAGATTTTACTTTCACCATCAGCAGCCTGCAGCCT
GAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCTCC
GCC
......@@ -128,7 +128,7 @@ GAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1203LL
>Intron 15/AG/14 KDE [IGK]
>Intron 15/AG/14 KDE [IGK+]
TTTTTTTTTTTTTTTTTTTTTTCAAGCAGAAGACGGCATACGAGATTTCACCGCGTGACTGGAGTTCAGACG
TGTGCTCTTCCGATCTGAGTGGCTT
TGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCTGTGTCTGCCC
......@@ -136,14 +136,14 @@ GATTGATGCTGCCGTAGAGAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1219NH
>IGKV2-28*01 0/A/11 KDE [IGK]
>IGKV2-28*01 0/A/11 KDE [IGK+]
GATTCAGTGGCAGTGGATCAGGCACAGATTTTACACTGAAAATCAGCAGAGTGGAGGCTGAGGATGTTGGGG
TTTATTACTGCATGCAAGCTCTACAAACTCCTCC
AGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1270BM
>Intron 0/GGGAGG/8 KDE [IGK]
>Intron 0/GGGAGG/8 KDE [IGK+]
TTTTTTTTTTTTTTTTTTTTTTTTTTCAAGCAGAAGACGGCATACGAGATACCTGGATGTGACTGGAGTTCA
GACGTGTGCTCTTCCGATCTG
AGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCTGT
......@@ -152,7 +152,7 @@ GGGAGG
AGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1270BM [IGK]
#target 1270BM [IGK+]
>IGKV1-8*01 10/TCCTCACCCGCCTAAGG/8 KDE
GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCTGCCTGCAGTCT
GAAGATTTTGCAACTTATTACTGTCAACAGTATTATA
......
......@@ -8,7 +8,7 @@ tccccctgatcctggagtcgcccagccccaaccagacccaaag
ctacgagcagtacttcgggccgggcaccaggctcacggttacaggtaag
#target 0447GG
>TRBD2*02 1/AATG/0 TRBJ2-3*01 [TRB] BUG
>TRBD2*02 1/AATG/0 TRBJ2-3*01 [TRB+] BUG
CAGGGCTGAGCGAACACCGGGGAGCTGTTTTTTGGAGAAGGCTCTAGGCTGACCGTACTGGGTAAGGAGGCG
GTTGGGGCTCCGGAGAGCTCCGAGAGGGCGGGATGGGCAGAGGTAAGCAGCTGCCCCACTCTGAGAGGGGCT
GTGCTGAGAGGTTTTTCCAAGCCCCACACAGTCAGACTAACCTCTGCCACCTGCGCTTCCTGCCGCTGCCCA
......@@ -37,14 +37,14 @@ GACTAGCGGGAGGGCCGGGGGGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAG
#target 1166TW
>TRBD2*02 2/AGGTTCT/8 TRBJ2-2*01 [TRB]
>TRBD2*02 2/AGGTTCT/8 TRBJ2-2*01 [TRB+]
TTTCCAAGCCCCACACAGTCAGACTAACCTCTGCCACCTGCGCTTCCTGCCGCTGCCCAGTGGTTGGGGGAG
GGGGACTAGCAGGGAGGAAACATTTTTGTATCATGGTGTAACATTGTGGGGACTAGCGGGAGAGGTTCT
GGGGAGCTGTTTTTTGGAGAAGGCTCTAGGCTGACCGTACTGGGTAAG
#target 1174OJ
>TRBD2*02 1/CG/6 TRBJ2-7*01 [TRB]
>TRBD2*02 1/CG/6 TRBJ2-7*01 [TRB+]
TTTCCAAGCCCCACACAGTCAGACTAACCTCTGCCACCTGCGCTTCCTGCCGCTGCCCAGTGGTTGGGGGAG
GGGGACTAGCAGGGAGGAAACATTTTTGTATCATGGTGTAACATTGTGGGGACTAGCGGGAGGCG
CGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAG
......@@ -81,7 +81,7 @@ CAGGACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAG
#target 1297RC
>TRBD2*01 2/CGGCTCTCACTA/2 TRBJ2-3*01 [TRB]
>TRBD2*01 2/CGGCTCTCACTA/2 TRBJ2-3*01 [TRB+]
TTTCCAAGCCCCACACAGTCAGACTAACCTCTGCCACCTGCGCTTCCTGCCGCTGCCCAGTGGTTGGGGGAG
GGGGACTAGCAGGGAGGAAACATTTTTGTATCATGGTGTAACATTGTGGGGACTAGCGGGGGCGGCTCTCAC
TACACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGGTGTGCGCG
......@@ -98,7 +98,7 @@ cacGAAGCTTTCTTTGGACAAGGCACCAGA
#target 1323DS
>TRBD2*01 0/CACTTTT/6 TRBJ2-7*01 [TRB]
>TRBD2*01 0/CACTTTT/6 TRBJ2-7*01 [TRB+]
TTTCCAAGCCCCACACAGTCAGACTAACCTCTGCCACCTGCGCTTCCTGCCGCTGCCCAGTGGTTGGGGGAG
GGGGACTAGCAGGGAGGAAACATTTTTGTATCATGGTGTAACATTGTGGGGACTAGCGGGGGGGCACTTTT
CGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAG
# target 1266MN
>IGHD4-4*01 5/GCACGAGG/5 IGHJ5*02 [IGH]
>IGHD4-4*01 5/GCACGAGG/5 IGHJ5*02 [IGH+]
AGATCCCCAGGACGCAGCACCACTGTCAATGGGGGCCCCAGACGCCTGGACCAGGGCCTGCGTGGGAAAGGC
CTCTGGGCACACTCAGGGGCTTTTTGTGAAGGGTCCTCCTACTGTGTGACTACAGTAGCACGAGGTGGTTCG
ACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG
# target 1266MN
>IGHD7-27 0/TCAAG/0 IGHJ4 [IGH]
>IGHD7-27 0/TCAAG/0 IGHJ4 [IGH+]
CACAGGCCCCCTACCAGCCGCAGGGTTTTGGCTGAGCTGAGAACCACTGTGCTAACTGGGGATCAAGACTAC
TTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG
......@@ -28,7 +28,7 @@ cggtatggacgtctggggccaagggaccacggtcaccgtctcctcagg
# target 1297RC
> TRGV5*01 (-6) 6/CCCCCGGG/0 TRGJ1*02 [TRG]
>TRGV5*01 6/CCCCCGGG/0 TRGJ1*02 [TRG]
tgccttctacatccactggtacctacaccaggaggggaaggccccacagcgtcttctgtactatgacgtctc
caactcaaaggatgtgttggaatcaggactcagtccaggaaagtattatactcatacacc
caggaggtggagctggatattgatactacgaaatctaattgaaaatgattctggggtctattactgtgccac
......@@ -36,21 +36,21 @@ ctggcccccgggttattataagaaactctttggcagtggaacaacacttgttgtcacaggtaagtatcggaa
# target 1297RC
> TRBD2*01 2/CGGCTCTCACTA/2 TRBJ2-3 [TRB]
>TRBD2*01 2/CGGCTCTCACTA/2 TRBJ2-3 [TRB+]
TTTCCAAGCCCCACACAGTCAGACTAACCTCTGCCACCTGCGCTTCCTGCCGCTGCCCAGTGGTTGGGGGAG
GGGGACTAGCAGGGAGGAAACATTTTTGTATCATGGTGTAACATTGTGGGGACTAGCGGGGGCGGCTCTCAC
TACACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGGTAAGCGGG
# target 1297RC
>TRDD2 0/CCACGGG/7 TRAJ9
>TRDD2 0/CCACGGG/7 TRAJ9 [TRA+D]
AGGGGTATTGTGGATGGCAGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTT
TTATACTGATGTGTTTCATTGTGCCTTCCTACCCACGGGCTGGAGGCTTCAAAACTATCTTTGGAGCAGGAA
CAAGACTATTTGTTAAAGCAAGTAAGTTCCATGAAATAACCTGATTTATATTACAGTTGAAGAACATCTGTT
TTCATTGATTTTTTTCTTTTTAGGGGGAAGGGGACATAGTTTTGTCTGCCAGTTAAA
# target 1297RC
>TRDD2*01 1/AATCTGGGATT/0 TRDD3*01 4/AG/24 TRAJ53*01
>TRDD2*01 1/AATCTGGGATT/0 TRDD3*01 4/AG/24 TRAJ53*01 [TRA+D]
AGGGGTATTGTGGATGGCAGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTT
TTATACTGATGTGTTTCATTGTGCCTTCCTAAATCTGGGATTACTGGGGGAAGAACTGACATTTGGAAAAGG
AACTCTCTTAACCGTGAATCCAAGTAAGTTTGAAGGGAGTGGGGGAAGGGGGAATTCAAACACTTCTGATTT
......@@ -66,7 +66,7 @@ cgacccctggggccagggaaccctggtcaccgtctcctcaggt
# target 1321HW
>IGKV4-1*01 3/0/0 KDE [IGK]
>IGKV4-1*01 3/0/0 KDE [IGK+]
ACAGCTCCACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTA
CTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCT
CACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCGGAGCC
......@@ -74,21 +74,21 @@ CTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCA
# target 1321HW
>TRDV2*01 4/TACA/1 TRDD3 [TRD]
>TRDV2*01 4/TACA/1 TRDD3 [TRD+]
GGGTGACATTGATATTGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTC
TTACTACTGTGCCTGTGATACACTGGGGGATACGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAAC
TGCAGGGGCAAAAG
# target 1321HW
>TRDV2*01 0/GGAGG/2 TRDD3 [TRD]
>TRDV2*01 0/GGAGG/2 TRDD3 [TRD+]
ATTGATATTGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTAC
TGTGCCTGTGACACCGGAGGTGGGGGATACGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGC
AGGGGCAAAAGT
# target 1321HW
>TRDD2 4/T/2 TRDD3 [TRD]
>TRDD2 4/T/2 TRDD3 [TRD+]
AGGGGTATTGTGGATGGCAGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGA
AGAGGGTTTTTATACTGATGTGTTTCATTGTGCCTTCTTGGGGGATACGCACAGTGCTACAAAACCTACAGA
GACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGG
......@@ -115,14 +115,14 @@ GAATATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAAGTAAT
# target 0933KC
>TRDD2 4/A/3 TRDD3 [TRD]
>TRDD2 4/A/3 TRDD3 [TRD+]
AGGGGTATTGTGGATGGCAGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTT
TTATACTGATGTGTTTCATTGTGCCTTCAGGGGGATACGCACAGTGCTACAAAACCTACAGAGACCTGTACA
AAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGG
# target 0933KC
>IGHD1-26 2/CCTCGGATTTTAAGA/11 IGHJ3 [IGH]
>IGHD1-26 2/CCTCGGATTTTAAGA/11 IGHJ3 [IGH+]
GGCGGAATGTGTGCAGGCCTCAGGCTCTGTGGGTGCCGCTAGCTGGGGCTGCCAGTCCTCACCCCACACCTA
AGGTGAGCCACAGCCGCCAGAGCCTCCACAGGAGACCCCACCCAGCAGCCCAGCCCCTACCCAGGAGGCCCC
AGAGCTCAGGGCGCCTGGGTGGATTCTGAACAGCCCCGAGTCACGGTGGGTATAGTGGGAGCTACTCCTCGG
......@@ -160,14 +160,14 @@ CTTTTCTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTC
#target 0934GO
>TRDD2*01 3/GGAAGGGGGG/10 TRDD3 [TRD]
>TRDD2*01 3/GGAAGGGGGG/10 TRDD3 [TRD+]
TGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTACTGTGCCTG
TGACGGAAGGGGGGACGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGCAGGGGCAAAAGTGC
CATTTCCCTGGG
#target 0934GO
>TRDV2*01 3/CGGAGG/19 TRAJ48*01 [TRD]
>TRDV2*01 3/CGGAGG/19 TRAJ48*01 [TRA+D]
TGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTACTGTGCCTG
TGACCGGAGGGAAATTAACCTTTGGGACTGGAACAAGACTCACCATCATACCCAGTAAGTTCTTCATCCTTG
GTCAGGAAATCAGCCTGCATAAGATTCTGGGGA
......@@ -189,10 +189,12 @@ ggggccagggaaccctggtcaccgtctcctcaggtaaa
#target 1119JC
>IGKV1-5*01 7/GCTTT/5 KDE [IGK]
>IGKV1-5*01 7/GCTTT/5 KDE [IGK+]
GGAAAGCCCCTAAGCTCCTGATCTATAAGGCGTCTAGTTTAAAAGTGGGGTCCCATCAAGGTTCAGCGGCCG
TGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCA
ACAGTATAATAGTTGCTTTCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCA
ACAGTATAATAGTT
GCTTT
CCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCA
TATCCACTATT
......@@ -205,14 +207,14 @@ cact
#target 1119JC
>TRDV2 7/CAGGG/1 TRDD3 [TRD]
>TRDV2 7/CAGGG/1 TRDD3 [TRD+]
TGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTACTGTGCCCA
GGGCTGGGGGATACGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCA
TTTCCCTGGG
#target 1119JC
>TRDV2 7/CAGGG/1 D3 4/GCCC/4 TRAJ29 [TRA+D]
>TRDV2 7/CAGGG/1 TRDD3 4/GCCC/4 TRAJ29 [TRA+D]
TGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTACTGTGCCCA
GGGCTGGGGGAGCCCTTCAGGAAACACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAG
TAAGTGTTTCTAGCCA
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment