Attention une mise à jour du serveur va être effectuée le lundi 17 mai entre 13h et 13h30. Cette mise à jour va générer une interruption du service de quelques minutes.

Commit f081f16f authored by Mathieu Giraud's avatar Mathieu Giraud

should-vdj: BRI_*, fix locus tags

parent 61e52780
#target 0956LC
>IGHV6-1*01 5/TCCCGATCGAGG/-6 IGHD3-10*01 -0/AACCT/-4 IGHJ6*02
>IGHV6-1*01 5/TCCCGATCGAGG/-6 IGHD3-10*01 -0/AACCT/-4 IGHJ6*02 [IGH]
......@@ -192,7 +192,7 @@ AGCCCTATAGTGAGTCGTATTA
#target 0969JS
>IGHV5-51*03 0/TTGAGAAGGGTTTTT/5 IGHD6-13*01 2/CCC/6 IGHJ4*02
>IGHV5-51*03 0/TTGAGAAGGGTTTTT/5 IGHD6-13*01 2/CCC/6 IGHJ4*02 [IGH]
#target 0990CE
>IGHV3-30*18 4/AAGATTCACCATA/21 IGHD32-21*01 0/GTCGGCCCC/2 IGHD3-22*01 7/CGC/10 IGHJ4*02 [IGH]
>IGHV3-30*18 4/AAGATTCACCATA/21 IGHD32-21*01 0/GTCGGCCCC/2 IGHD3-22*01 7/CGC/10 IGHJ4*02 [IGH+]
#target 0728LH
#target 0732EC
#15//0 is too permissive
>IGKV2D-30*01 17/AG/0 KDE [IGK] BUG
>IGKV2D-30*01 17/AG/0 KDE [IGK+] BUG
#target 0732EC
>Intron 2/GA/2 KDE [IGK]
>Intron 2/GA/2 KDE [IGK+]
#target 0862PT
#end of IGKV2-30*01/15 is ...aaggTac
>IGKV2-30*01 (12//15, 15/CAC/15) KDE [IGK]
>IGKV2-30*01 (12//15, 15/CAC/15) KDE [IGK+]
#target 0931JS
#target 0931JS
>Intron 2/AGGGGGT/4 KDE [IGK]
>Intron 2/AGGGGGT/4 KDE [IGK+]
#target 0990CE
>IGKV4-1*01 0/CCACAAAT/16 KDE [IGK+]
#target 1012SP
#target 1025TT
>IGKV2-24*01 0/TGT/19 KDE [IGK]
>IGKV2-24*01 0/TGT/19 KDE [IGK+]
#target 1026TM
#start of KDE/2 is agCcct...
#target 1026TM
>Intron 2/C/0 KDE [IGK]
>Intron 2/C/0 KDE [IGK+]
#target 1089IH
#8/ACT/1 is too permissive
#target 1163SC
>Intron 5/CCGTCATCC/1 KDE [IGK+]
#target 1200CT
#end of IGKV1-17*10 is ...tacccTcc
>IGKV1-17*01 (0//16, 3/CCC/16) KDE [IGK]
>IGKV1-17*01 (0//16, 3/CCC/16) KDE [IGK+]
#target 1203LL
>IGKV1-33*01 0/GCC/1 KDE [IGK]
>IGKV1-33*01 0/GCC/1 KDE [IGK+]
#target 1203LL
>Intron 15/AG/14 KDE [IGK]
>Intron 15/AG/14 KDE [IGK+]
#target 1219NH
>IGKV2-28*01 0/A/11 KDE [IGK]
>IGKV2-28*01 0/A/11 KDE [IGK+]
#target 1270BM
>Intron 0/GGGAGG/8 KDE [IGK]
>Intron 0/GGGAGG/8 KDE [IGK+]
......@@ -152,7 +152,7 @@ GGGAGG
#target 1270BM [IGK]
#target 1270BM [IGK+]
......@@ -8,7 +8,7 @@ tccccctgatcctggagtcgcccagccccaaccagacccaaag
#target 0447GG
>TRBD2*02 1/AATG/0 TRBJ2-3*01 [TRB] BUG
>TRBD2*02 1/AATG/0 TRBJ2-3*01 [TRB+] BUG
#target 1166TW
>TRBD2*02 2/AGGTTCT/8 TRBJ2-2*01 [TRB]
>TRBD2*02 2/AGGTTCT/8 TRBJ2-2*01 [TRB+]
#target 1174OJ
>TRBD2*02 1/CG/6 TRBJ2-7*01 [TRB]
>TRBD2*02 1/CG/6 TRBJ2-7*01 [TRB+]
#target 1297RC
......@@ -98,7 +98,7 @@ cacGAAGCTTTCTTTGGACAAGGCACCAGA
#target 1323DS
>TRBD2*01 0/CACTTTT/6 TRBJ2-7*01 [TRB]
>TRBD2*01 0/CACTTTT/6 TRBJ2-7*01 [TRB+]
# target 1266MN
>IGHD4-4*01 5/GCACGAGG/5 IGHJ5*02 [IGH]
>IGHD4-4*01 5/GCACGAGG/5 IGHJ5*02 [IGH+]
# target 1266MN
>IGHD7-27 0/TCAAG/0 IGHJ4 [IGH+]
......@@ -28,7 +28,7 @@ cggtatggacgtctggggccaagggaccacggtcaccgtctcctcagg
# target 1297RC
> TRGV5*01 (-6) 6/CCCCCGGG/0 TRGJ1*02 [TRG]
......@@ -36,21 +36,21 @@ ctggcccccgggttattataagaaactctttggcagtggaacaacacttgttgtcacaggtaagtatcggaa
# target 1297RC
# target 1297RC
# target 1297RC
>TRDD2*01 1/AATCTGGGATT/0 TRDD3*01 4/AG/24 TRAJ53*01
>TRDD2*01 1/AATCTGGGATT/0 TRDD3*01 4/AG/24 TRAJ53*01 [TRA+D]
......@@ -66,7 +66,7 @@ cgacccctggggccagggaaccctggtcaccgtctcctcaggt
# target 1321HW
>IGKV4-1*01 3/0/0 KDE [IGK]
>IGKV4-1*01 3/0/0 KDE [IGK+]
# target 1321HW
>TRDV2*01 4/TACA/1 TRDD3 [TRD]
>TRDV2*01 4/TACA/1 TRDD3 [TRD+]
# target 1321HW
>TRDV2*01 0/GGAGG/2 TRDD3 [TRD+]
# target 1321HW
>TRDD2 4/T/2 TRDD3 [TRD]
>TRDD2 4/T/2 TRDD3 [TRD+]
# target 0933KC
>TRDD2 4/A/3 TRDD3 [TRD]
>TRDD2 4/A/3 TRDD3 [TRD+]
# target 0933KC
#target 0934GO
#target 0934GO
>TRDV2*01 3/CGGAGG/19 TRAJ48*01 [TRD]
>TRDV2*01 3/CGGAGG/19 TRAJ48*01 [TRA+D]
......@@ -189,10 +189,12 @@ ggggccagggaaccctggtcaccgtctcctcaggtaaa
#target 1119JC
>IGKV1-5*01 7/GCTTT/5 KDE [IGK]
>IGKV1-5*01 7/GCTTT/5 KDE [IGK+]
......@@ -205,14 +207,14 @@ cact
#target 1119JC
#target 1119JC
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment