tests: update tests stanford-labels{,-W,-FaW}.should_get for default -w 50

The purpose of these tests is to check whether the reads with labeled windows
are kept, and not to test the VDJ segmentation on these difficult reads.

algo/tests/stanford-labels-FaW.should_get

-!LAUNCH: ../../vidjil -w 60 -G ../../germline/IGH -FaW TGTGCGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTAC ../../data/Stanford_S22.fasta ; cat out/seq/clone.fa-1
+!LAUNCH: ../../vidjil -G ../../germline/IGH -FaW GAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACT ../../data/Stanford_S22.fasta ; cat out/seq/clone.fa-1
 
 $ Keep only one windows, the one given by -W, with only 5 reads (it is actually the second clone in Stanford_S22.fasta)
 1: keep 1 windows in 5 reads

algo/tests/stanford-labels-W.should_get

-!LAUNCH: ../../vidjil -w 60 -G ../../germline/IGH -r 5 -W TGTGCGAGAGATGGACGGGATACGTAAAACGACATATGGTTCGGGGTTTGGTGCTTTTGA ../../data/Stanford_S22.fasta
+!LAUNCH: ../../vidjil -G ../../germline/IGH -r 5 -W GAGAGATGGACGGGATACGTAAAACGACATATGGTTCGGGGTTTGGTGCT ../../data/Stanford_S22.fasta
 
-$ Keep the good number of windows, including one window labeled by -W
-1: keep 3 windows
-
-$ The third clone has only one windows and the good label
-1: clone-003.*0001-.* -W
+$ Some clone has only one read, bypassing the -r 5 option, and the good label
+1: clone-00..*0001-.* -W
 
 

algo/tests/stanford-labels.should_get

-!LAUNCH: ../../vidjil -w 60 -G ../../germline/IGH -r 5 -l ../../data/Stanford_S22.label ../../data/Stanford_S22.fasta
+!LAUNCH: ../../vidjil -G ../../germline/IGH -r 5 -l ../../data/Stanford_S22.label ../../data/Stanford_S22.fasta
 
-$ Keep the good number of windows, including one window labeled in Stanford_S22.label
-1: keep 3 windows
-
-$ The third clone has only one windows and the good label
-1: clone-003.*0001-.* my-clone
+$ Some clone has only one read, bypassing the -r 5 option, and the good label
+1: clone-00..*0001-.* my-clone
 
 

data/Stanford_S22.label

-TGTGCGAGAGATGGACGGGATACGTAAAACGACATATGGTTCGGGGTTTGGTGCTTTTGA my-clone
+GAGAGATGGACGGGATACGTAAAACGACATATGGTTCGGGGTTTGGTGCT my-clone