Mise à jour terminée. Pour connaître les apports de la version 13.8.4 par rapport à notre ancienne version vous pouvez lire les "Release Notes" suivantes :

Commit ef0e2f3f authored by Mathieu Giraud's avatar Mathieu Giraud

tests: update tests stanford-labels{,-W,-FaW}.should_get for default -w 50

The purpose of these tests is to check whether the reads with labeled windows
are kept, and not to test the VDJ segmentation on these difficult reads.
parent 73c50f08
!LAUNCH: ../../vidjil -w 60 -G ../../germline/IGH -FaW TGTGCGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTAC ../../data/Stanford_S22.fasta ; cat out/seq/clone.fa-1
!LAUNCH: ../../vidjil -G ../../germline/IGH -FaW GAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACT ../../data/Stanford_S22.fasta ; cat out/seq/clone.fa-1
$ Keep only one windows, the one given by -W, with only 5 reads (it is actually the second clone in Stanford_S22.fasta)
1: keep 1 windows in 5 reads
!LAUNCH: ../../vidjil -w 60 -G ../../germline/IGH -r 5 -W TGTGCGAGAGATGGACGGGATACGTAAAACGACATATGGTTCGGGGTTTGGTGCTTTTGA ../../data/Stanford_S22.fasta
!LAUNCH: ../../vidjil -G ../../germline/IGH -r 5 -W GAGAGATGGACGGGATACGTAAAACGACATATGGTTCGGGGTTTGGTGCT ../../data/Stanford_S22.fasta
$ Keep the good number of windows, including one window labeled by -W
1: keep 3 windows
$ The third clone has only one windows and the good label
1: clone-003.*0001-.* -W
$ Some clone has only one read, bypassing the -r 5 option, and the good label
1: clone-00..*0001-.* -W
!LAUNCH: ../../vidjil -w 60 -G ../../germline/IGH -r 5 -l ../../data/Stanford_S22.label ../../data/Stanford_S22.fasta
!LAUNCH: ../../vidjil -G ../../germline/IGH -r 5 -l ../../data/Stanford_S22.label ../../data/Stanford_S22.fasta
$ Keep the good number of windows, including one window labeled in Stanford_S22.label
1: keep 3 windows
$ The third clone has only one windows and the good label
1: clone-003.*0001-.* my-clone
$ Some clone has only one read, bypassing the -r 5 option, and the good label
1: clone-00..*0001-.* my-clone
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment