Commit edc7e2fe authored by Mathieu Giraud's avatar Mathieu Giraud

tests: update tests (-u, -U), add test (-K)

parent b2170d29
!LAUNCH: ../../vidjil -r 5 -K -g ../../germline ../../data/multi-short.fa ; head -n 15 out/multi-short.affects
# Testing .affects output (-K)
$ First sequence (TRA), display sequence
1:TCTTCATTCCTTAGTCGCTCTGATAGTTATGGTTACCTCCTTCTACAGGAGCTCCAGATGAAAGACTCTGCCTCTTACTTCTGCGCTGTGAGAGAGTATGAAAGTATTACCTCCCAGTTGCAATTTGGCAAAGGAACCAGAGTTTCCACTTCTCC
$ First sequence (TRA), count of k-mers
1:.TRA .* 129
$ First sequence (TRA), segmentation
1:>TRA--V1-1.01--J1.01 .* seed TRA SEG_+
!LAUNCH: ../../vidjil -r 5 -o out2 -u -U -v -G ../../germline/IGH ../../data/Stanford_S22.fasta ; tail out2/Stanford_S22.segmented.vdj.fa ; grep not out2/Stanford_S22.affects
!LAUNCH: ../../vidjil -r 5 -o out2 -u -U -v -G ../../germline/IGH ../../data/Stanford_S22.fasta ; tail out2/Stanford_S22.segmented.vdj.fa ; grep UNSEG out2/Stanford_S22.unsegmented.vdj.fa
# Testing uncommon and debug options
$ verbose (-v)
2:auditioned sequences
$ segmented.fa (-U)
1:>lcl.FLN1FA001BCDD7.1. .* seed IGH
1:>lcl.FLN1FA001BCDD7.1. .* seed IGH SEG
$ unsegmented.fa (-u)
1:>lcl.FLN1FA002PX5D6.1. not segmented
1:>lcl.FLN1FA002PX5D6.1. .* UNSEG
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment