Commit ebb09977 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: at least 3-4 nt of upstream DD2 to detect the TRD+ recombination

This was already the case before, we make it clearer.
Closes #4725.
parent eed20649
......@@ -3,21 +3,33 @@ gcaccatcagagagagatgaagggtcttactactgtgcctgtgacacc
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa
# without DD2 upstream, the recombination can not be detected, 'TODO' is expected here
>TRDD2*01_0//0_TRDJ1*01 [TRD+] TODO
ccttcctac
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa
# same sequence, with DD2 upstream
# same sequence, with some DD2 upstream
>TRDD2*01_0//0_TRDJ1*01 [TRD+]
TGTGccttcctac
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa
# same sequence, with more DD2 upstream
>TRDD2*01_0//0_TRDJ1*01 [TRD+]
TGTGTTTCATTGTGccttcctac
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa
# without DD2 upstream, the recombination can not be detected, 'TODO' is expected here
>TRDD2*01_0//0_TRDD3*01 [TRD+] TODO
ccttcctac
actgggggatacg
# same sequence, with DD2 upstream and DD3 downstream
# same sequence, with some DD2 upstream
>TRDD2*01_0//0_TRDD3*01 [TRD+]
GTGccttcctac
actgggggatacg
# same sequence, with more DD2 upstream and DD3 downstream
>TRDD2*01_0//0_TRDD3*01 [TRD+]
TGTGTTTCATTGTGccttcctac
actgggggatacgCACAGTGCTA
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment