Commit e8362e16 authored by Mikaël Salson's avatar Mikaël Salson

BRI_IGH: Typo when changing locus

Fix f081f16f
parent a03faeba
......@@ -218,7 +218,7 @@ TTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT
#target 0990CE
>IGHV3-30*18 4/AAGATTCACCATA/21 IGHD32-21*01 0/GTCGGCCCC/2 IGHD3-22*01 7/CGC/10 IGHJ4*02 [IGH+]
>IGHV3-30*18 4/AAGATTCACCATA/21 IGHD32-21*01 0/GTCGGCCCC/2 IGHD3-22*01 7/CGC/10 IGHJ4*02 [IGH]
TGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCT
TCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCAT
ATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGA
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment