Commit e5952d44 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

Merge branch 'feature-g/3910-avoir-des-germline-de-poulet' into 'dev'

Resolve "Avoir des germline de poulet"

Closes #3910

See merge request !470
parents eca7b0ac f9b86544
Pipeline #79815 passed with stages
in 5 minutes and 57 seconds
"ref": "",
"species": "Gallus gallus; including red junglefowl",
"species_taxon_id": 9031,
"path": "gallus-gallus",
"systems": {
"IGH": {
"shortcut": "H",
"color" : "#6c71c4",
"description": "Gallus immunoglobulin, heavy locus",
"recombinations": [ {
"5": ["IGHV.fa"],
"4": ["IGHD.fa"],
"3": ["IGHJ.fa"]
} ],
"parameters": {
"seed": "12s"
"IGH+": {
"shortcut": "h",
"color" : "#8c91e4",
"description": "Gallus immunoglobulin, heavy locus, incomplete Dh-Jh recombinations",
"follows": "IGH",
"recombinations": [ {
"5": ["IGHD+up.fa"],
"3": ["IGHJ+down.fa"]
} ],
"parameters": {
"seed": "12s"
"IGL": {
"shortcut": "L",
"color" : "#d33682",
"description": "Gallus immunoglobulin, lambda locus",
"recombinations": [ {
"5": ["IGLV.fa"],
"3": ["IGLJ.fa"]
} ],
"parameters": {
"seed": "10s"
......@@ -68,7 +68,7 @@ def gene_matches(string, list_regex):
results = []
for regex in list_regex:
match =, string)
if match <> None:
if match != None:
return results
......@@ -274,7 +274,9 @@ SPECIES = {
"Mus musculus_C57BL/6": 'mus-musculus/',
"Rattus norvegicus": 'rattus-norvegicus/',
"Rattus norvegicus_BN/SsNHsdMCW": 'rattus-norvegicus/',
"Rattus norvegicus_BN; Sprague-Dawley": 'rattus-norvegicus/'
"Rattus norvegicus_BN; Sprague-Dawley": 'rattus-norvegicus/',
"Gallus gallus": "gallus-gallus/",
"Gallus gallus_Red Jungle fowl": "gallus-gallus/"
!LAUNCH: (cd $VIDJIL_DIR/germline ; cat gallus-gallus/IGHV.fa | tr '|' '#' )
$ Found sequence of Gallus gallus Red Jungle fowl
1: .*#IGHV1-1.01#Gallus gallus_Red Jungle fowl#
$ Found sequence of Gallus gallus
1: .*#IGHV1-21.*#Gallus gallus#
$ Found a sequence part of IGHV1-1*01
i1: tgggtgcgacaggcgcccggcaaggggctggagtgggtcgctggtattggcagcagt
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment