Commit e504f7ad authored by Mikaël Salson's avatar Mikaël Salson

Tests: Add $LAUNCHER in functional tests to test with valgrind.

By default the launcher is put at the start of the command line. In some cases
it must not be at the start and in other cases we don't want to use valgrind
(or another launcher) so we deactivate it with the !NO_LAUNCHER: directive
parent 7badc044
!NO_LAUNCHER:
!LAUNCH: (cd ../../data ; md5sum *.fasta || md5 -r *.fasta)
$ Check md5 in data/
......
!NO_LAUNCHER:
!LAUNCH: (cd ../../germline ; md5sum *.fa || md5 -r *.fa)
$ Check md5 in germline/, sequences split from IMGT
......
!LAUNCH: export REQUEST_METHOD=POST ; export CONTENT_TYPE=test ; ../../browser/cgi/align.cgi < ../../data/msa.fa
!LAUNCH: export REQUEST_METHOD=POST ; export CONTENT_TYPE=test ; $LAUNCHER ../../browser/cgi/align.cgi < ../../data/msa.fa
$ no spurious info
0: .* bp in .* sequences
......
!NO_LAUNCHER:
!LAUNCH: ../../vidjil -G ../../germline/IGH ../../data/clones_simul.fa > out-fa ; ../../vidjil -G ../../germline/IGH -b clones_simul ../../data/clones_simul.fa.gz > out-fa-gz ; diff -s -I '\#' -I 'index' -I 'data/clones_simul' out-fa out-fa-gz ; echo 'Diff: '\\$?; wc -l out-fa-gz
$ Identical output
......
!LAUNCH: (for i in {1..10000}; do echo '>read' ; echo ccgtgtattactgtgcgagagagctgaatacttccagcactg ; done ;) > same-igh-10k.fa ; ../../vidjil -G ../../germline/IGH -r 5000 -w 15 same-igh-10k.fa; rm -f same-igh-10k.fa
!LAUNCH: (for i in {1..10000}; do echo '>read' ; echo ccgtgtattactgtgcgagagagctgaatacttccagcactg ; done ;) > same-igh-10k.fa ; $LAUNCHER ../../vidjil -G ../../germline/IGH -r 5000 -w 15 same-igh-10k.fa; rm -f same-igh-10k.fa
$ Find a unique clone with all reads
1:>clone-001--IGH--0010000--100.--window
......
!LAUNCH: (cd ../.. ; ./vidjil -c germlines -s '######-######' data/Stanford_S22.fasta)
!LAUNCH: (cd ../.. ; $LAUNCHER ./vidjil -c germlines -s '######-######' data/Stanford_S22.fasta)
$ number of reads and kmers
1:13153 reads, 3020179 kmers
......
!LAUNCH: ../../vidjil -k 9 -G ../../germline/IGH -% 0.001 -r 4 -c clones ../../data/Stanford_S22.fasta > vidjil_s22.log && ../../vidjil -k 9 -G ../../germline/IGH -% 0.001 -r 4 -c clones ../../data/Stanford_S22.rc.fasta > vidjil_s22_rc.log && diff vidjil_s22.log vidjil_s22_rc.log
!LAUNCH: $LAUNCHER ../../vidjil -k 9 -G ../../germline/IGH -% 0.001 -r 4 -c clones ../../data/Stanford_S22.fasta > vidjil_s22.log && $LAUNCHER ../../vidjil -k 9 -G ../../germline/IGH -% 0.001 -r 4 -c clones ../../data/Stanford_S22.rc.fasta > vidjil_s22_rc.log && diff vidjil_s22.log vidjil_s22_rc.log
$ Same number segmented
0:==> segmented
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment