Commit e023d5b4 authored by Thonier Florian's avatar Thonier Florian Committed by Mathieu Giraud
Browse files

germline; add tests on 3 seuqences of gallus gallus (each IGL)

link to #3910
parent 38108d2f
# each of these sequences are compatible with allele 01 & 02.
# So a warning will be called
>IGLV1-1*01 0//2 IGLJ*01
CTGGGGTCCAAGCCGACGACGAGGCTGTCTATTACTGTGGGAGTGCAGACAGCAGCAGTACTGCTGGTATATTTGGGGCCGGGACAACCCTGACCGTCCTAGGCCAGCCCAAGGTGGCCCCCACCATCACCCTCTTCCCA
>IGLV1-1*01 0/C/6 IGLJ*01
GGTCCAAGCCGACGACGAGGCTGTCTATTACTGTGGGAGTGCAGACAGCAGCAGTACTGCTGCATTTGGGGCCGGGACAACCCTGACCGTCCTAGGCCAGCCCAAGGTGGCCCCCACCATCACCCTCTTCCCACCGTCAAAG
>IGLV1-4*01 0//6 IGLJ*01
GCCGACGACGAGGCTGTCTATTACTGTGGGAGTGCAGACAGCAGCTATGTTGGTATATTTGGGGCCGGGACAACCCTGACCGTCCTAGGCCAGCCCAAGGTGGCCCCCACCATCACCCTCTTCCCACCGTCAAAGGA
\ No newline at end of file
!LAUNCH: $VIDJIL_DIR/$EXEC -3 -c designations -g $VIDJIL_DIR/germline/gallus-gallus.g $VIDJIL_DATA/specie_gallus-gallus.fa
# each sequence here can be allele *01 or *02.
$ First clone is correctly found
1:IGLV1-1*01 0//2 IGLJ*01
$ Second clone is correctly found
1:IGLV1-1*01 0/C/6 IGLJ*01
$ Third clone is correctly found
1:IGLV1-4*01 0//6 IGLJ*01
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment