Merge branch 'feature-a/3572-3573-more-airr-fields' into 'dev'

Feature a/3572 3573 more airr fields

Closes #3573 and #3572

See merge request !338

algo/core/output.cpp

@@ -13,14 +13,23 @@ string getout(json v)
 
 string Output::get(string key)
 {
+  if (!j.count(key)) return NULL_VAL ;
+
   return getout(j[key]);
 }
 string Output::get(string key, string subkey)
 {
+  if (!j.count(key)) return NULL_VAL ;
+  if (!j[key].count(subkey)) return NULL_VAL ;
+
   return getout(j[key][subkey]);
 }
 string Output::get(string key, string subkey, string subsubkey)
 {
+  if (!j.count(key)) return NULL_VAL ;
+  if (!j[key].count(subkey)) return NULL_VAL ;
+  if (!j[key][subkey].count(subsubkey)) return NULL_VAL ;
+
   return getout(j[key][subkey][subsubkey]);
 }
 
@@ -56,6 +65,18 @@ int CloneOutput::reads()
   return j["reads"][0];
 }
 
+string CloneOutput::getWarnings()
+{
+  string warnings = "" ;
+
+  if (!j.count("warn")) return warnings ;
+
+  for (json w: j["warn"])
+  {
+    warnings +=  w["code"].get<std::string>() + " ";
+  }
+}
+
 
 CloneOutput::~CloneOutput()
 {
@@ -120,6 +141,13 @@ void SampleOutputVidjil::out(ostream &s)
 
 // AIRR .tsv output
 
+string TF_format_bool(string val)
+{
+  if (val == "false") return "F" ;
+  if (val == "true") return "T" ;
+  return val ;
+}
+
 map <string, string> CloneOutputAIRR::fields()
 {
   map <string, string> fields;
@@ -133,6 +161,14 @@ map <string, string> CloneOutputAIRR::fields()
   fields["v_call"] = get(KEY_SEG, "5", "name");
   fields["d_call"] = get(KEY_SEG, "4", "name");
   fields["j_call"] = get(KEY_SEG, "3", "name");
+  
+  fields["cdr3_aa"] = get(KEY_SEG, "cdr3", "aa");
+  fields["junction"] = NULL_VAL;
+  fields["junction_aa"] = get(KEY_SEG, "junction", "aa");
+  fields["productive"] = TF_format_bool(get(KEY_SEG, "junction", "productive"));
+  fields["rev_comp"] = NULL_VAL;
+
+  fields["warnings"] = getWarnings();
 
   return fields;
 }
@@ -145,6 +181,13 @@ void SampleOutputAIRR::out(ostream &s)
     "v_call", "d_call", "j_call",
     "sequence_id",
     "sequence",
+    
+    "productive",
+    "junction_aa",
+    "junction",
+    "cdr3_aa",
+    "warnings",
+    "rev_comp",
     "sequence_alignment",
     "germline_alignment",
     "v_cigar", "d_cigar", "j_cigar",

algo/core/output.h

@@ -37,6 +37,7 @@ public:
   virtual ~CloneOutput();
 
   int reads();
+  string getWarnings();
 
   void setSeg(string subkey, json val);
 

algo/tests/should-get-tests/airr-S22.should-get

@@ -5,13 +5,16 @@ $ There are four lines, all with tabs
 4:\t
 
 $ The required AIRR fields are present
-:consensus_count	
 :v_call	d_call j_call
 :sequence_id
 :sequence	
 :sequence_alignment	
 :germline_alignment
-:v_cigar	d_cigar	j_cigar	
+:v_cigar d_cigar	j_cigar	
+:junction
+:junction_aa
+:productive
+:rev_comp
 
 $ Three clones on IGH
 3:IGH
@@ -20,12 +23,23 @@ $ One clone has 8 reads, two clones have 5 reads
 1:IGH 8
 2:IGH 5
 
+$ Two clones are productive, no clone is labeled as non-productive
+2:\tT\t
+0:\tF\t
+
 $ v_call for 2 clones (-z 2)
 2:IGHV
 
 $ First clone window appears third times (clone_id, sequence_id, sequence)
 w3:TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
 
+$ Junction of the first clone appears once, but CDR3 twice (it is also included in the junction)
+1:CTREEQYSSWYFDFW		
+w2:TREEQYSSWYFDF
+
+$ The first clone has three warnings
+1:W51 W69 W69
+
 $ No spurious character
 0:"
 0:@