Commit de1dc944 authored by florian.thonier's avatar florian.thonier Committed by Mathieu Giraud

bug: segmented sequence, but without V(D)J designation

parent 60206ed1
# ./vidjil -g /Users/magiraud/vidjil/germline -A algo/tests/bugs/bug20150909.fa
# The sequences are segmented, but not fine-segmented (UNSEG < delta_min)
>R
GACATAGCTACCTACTACTGTGCCTTGTGGCACAACACTTGTTGTCACAGGTAAGTATCG
>B
CAGCAGGAGGACTCGGCCGTGTATCTCTGTGCCAGCAGCTTTAGCACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGGTAAGCGGGGGCTCCCGCTGAAGCCCGGGAACTGGGGAGGGGGCGCCCCGGGACGCCGGG
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment