Commit ddb2cc91 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: cgi-align.should_get, testing core/lazy_msa.cpp

parent 79cc662a
!LAUNCH: export REQUEST_METHOD=POST ; export CONTENT_TYPE=test ; ../../browser/cgi/align.cgi < ../../data/msa.fa
$ seq1 (reference sequence for lazy msa)
1:-AT-GATCAGCC-TGAGAGATAC
$ seq2
1:-AT-CAAGAGCCATGAGAG----
$ seq3
1:GATAGAACAGC--TGAGAG----
>seq1
ATGATCAGCCTGAGAGATAC
>seq2
ATCAAGAGCCATGAGAG
>seq3
GATAGAACAGCTGAGAG
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment