Commit db05a97f authored by Thonier Florian's avatar Thonier Florian
Browse files

Add sequences for test on warning for near segments expected.

Link to #4412
parent 7205a957
Pipeline #158844 passed with stages
in 39 minutes and 49 seconds
# Sequence from sanger and from capture.
# with capture, the sequence is too short to get the correct segment
# Few mismatch between both segments.
>seq_capture
------------------------------------------------------------
------------------------------------------------------------
------------------------------------------------------------
--------------GGGCCGGTTCACCGTCTCCAGGGACAACGCCAAGAACTCGCTGTTT
CTGCAAATCAACAGCCTGAGAGCCGAAGACACGGGCGTTTATTACTGTGCGAGGTTATAT
TCCCCTGCCATAGTCCCCTATTACTCCTACTACTACATGGACGTCTGGGGCAAAGGGACC
TCGGTCACCGTCTCCTCAGGTAAGAATGGCCATTTTAGGGCCTTTG
>V3-21 (expected)
gaggtgcagctggtggagtctgggggaggcctggtcaagcctggggggtccctgagactc
tcctgtgcagcctctggattcaccttcagtagctatagcatgaactgggtccgccaggct
ccagggaaggggctggagtgggtctcatccattagtagtagtagtagttacatatactac
gcagactcagtgaagggccgattcaccatctccagagacaacgccaagaactcactgtat
ctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaga----
------------------------------------------------------------
----------------------------------------------
>seq_sanger
-----GCAGCTGGTGGAGTCGGGGGGAGGCCTGGTCAAGCGGGGGGGGTCCCTGAGACTC
TCCTGTGTAGGCTCTGGATTCGCCTTCAATTCCTATGCCTTAAACTGGGTCCGCCGGACT
CCAGGGAAGGGGCTGGAGTGGGTCTCATCCATCAGCACTACTAGTCGTTACATCTACTTC
GCAGACTCATTGCAGGGCCGGTTCACCGTCTCCAGGGACAACGCCAAGAACTCGCTGTTT
CTGCAAATCAACAGCCTGAGAGCCGAAGACACGGGCGTTTATTACTGTGCGAGGTTATAT
TCCCCTGCCATAGTCCCCTATTACTCCTACTACTACA-----------------------
----------------------------------------------
>v3-11 (found)
caggtgcagctggtggagtctgggggaggcttggtcaagcctggagggtccctgagactc
tcctgtgcagcctctggattcaccttcagtgactactacatgagctggatccgccaggct
ccagggaaggggctggagtgggtttcatacattagtagtagtggtagtaccatatactac
gcagactctgtgaagggccgattcaccatctccagggacaacgccaagaactcactgtat
ctgcaaatgaacagcctgagagccgaggacacggccgtgtattactgtgcgagaga----
------------------------------------------------------------
----------------------------------------------
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment