Commit daecacba authored by flothoni's avatar flothoni Committed by Mathieu Giraud
Browse files

ERG: add 4 sequences recombination involving ERG segment like

parent e4e9de97
>patient_19498_1
TCAGCTTCGGTGGTCCACAGCCACCCTCTCCCTTTCTTCACTCTAGCCTCACGCACCAGAAAGCCCCAAGTGTTCGGGTCTTAGACTATGATTTATTGTAATCTGTTTGGTAAGCCATTCCAAATTCTTTTTTTTTTTACTTTTGGAAAAAGTGGGAGGTATCCATTTTTTAAATAATTGGAAATGTCCTCTTTTTTTGTT
>patient_19498_2
GGTCCACAGCCACCCTCTCCCTTTCTTCACTCTAGCCTCACGCACCAGAAAGCCCCAAGTGTTCGCTCCTTACGTCTCTTCTCAGCCTTCTGCTCAGCTTTTCATTTGCAACTCTGCCATATAACCATTCAAATAAAAATAATGACTATGTTTTGAGATGATTATTATCAGTCATGCTTCAGGAAGACTGATCTGGCAGCAATGTTCAGGATAG
>patient_19498_3
CTATCCTGAACATTGCTGCCAGATCAGTCTTCCTGAAGCATGACTGATAATAATCATCTCAAAACATAGTCATTATTTTTATTTGAATGGTTATATGGCAGAGTTGCAAATGAAAAGCTGAGCAGAAGGCTGAGAAGAGACAGGGCACTTGGGGCTTTCTGGTGCGTGAGGCTAGAGTGAAGAAAGGGAGAGGGTGGCTGTGGACCACCGAAGCTGA
>patient_13444_majo
TCAGCTTCGGTGGTCCACAGCCACCCTCTCCCTTTCTTCACTCTAGCCTCACGCACCCCTGTTTATCTTAGACTATGATTTATTGTAATCTGTTTGGTAAGCCATTCCAAATTCTTTTTTTTTTTACTTTTGGAAAAAGTGGGAGGTATCCATTTTTTAAATAATTGGAAATGTCCTCTTTTTTTGTTACAGTGTTTACATTTGATTTCGTCAGAAAGGAAAATTTTTCCTTACCGTGAGATGCTTCTGAGT
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens-isoforms.g -r 1 -e 0.1 $VIDJIL_DATA/erg_debre.fa
$ All sequences have been seen as different ERG recombinations
1: found 4 windows in 4 reads
1: ERG .* -> .* 4
### cas patient 19498 ###
$ Find the correct assignation for the sequence
1: ERG-4F 70/CCCGAACACTTGGGGCTTTCT/0 ERG-Init-R
$ Find the correct assignation for the sequence
1: ERG-1F 125/GTAAGGAGCGAACACTTGGGGCTTTCT/0 ERG-Init-R
$ Find the correct assignation for the sequence
1: ERG-4F 64/GG/0 ERG-Init-R
### cas patient 13444 ###
$ Find the correct assignation for the sequence
1: ERG-1F 105//0 ERG-Init-R
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment