Skip to content

GitLab

vidjil
vidjil
Commit da462732 authored by Mikaël Salson's avatar Mikaël Salson
Browse files
Options

algo/tests/bugs/bug3009: Add sequence from #3009 

Ensure that this sequence is properly analysed.
parent 757185a9
Pipeline #33008 canceled with stages
                  in 8 seconds
                  Hide whitespace changes
                  Inline Side-by-side
                  Showing with 10 additions and 0 deletions
                  algo/tests/bugs/bug3009.fa 0 → 100644
                  View file @ da462732
                  >TRDD2 28/CAA/2 TRDD3 [TRD+]
                  AGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTTTTATCAATGGGGGATACGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGGTCCCA
                  algo/tests/bugs/bug3009.should-get 0 → 100644
                  View file @ da462732
                  !LAUNCH: $VIDJIL_DIR/$EXEC -e 1e-5 -g $VIDJIL_DIR/germline -r 1 bug3009.fa
                  $ Segmented as TRD+
                  1: TRD\+ -> 1
                  1: SEG_\+ -> 1
                  $ VDJ assignation
                  1:TRDD2.01 28/CAA/2 TRDD3.01
                  Markdown is supported
                  0% or .
                  You are about to add 0 people to the discussion. Proceed with caution.
                  Finish editing this message first!
                  Please register or to comment