Commit da0e20ee authored by Mathieu Giraud's avatar Mathieu Giraud

doc/should-vdj.org: document .should-vdj.fa testing

parent 21158654
#+TITLE: should-vdj.fa -- Sequences with manually curated V(D)J designations
#+AUTHOR: The Vidjil team
#+HTML_HEAD: <link rel="stylesheet" type="text/css" href="../css/org-mode.css" />e
# contact@vidjil.org
* A quality control of bioinformatics analysis
The =.should-vdj.fa= tests are sequences with manually curated V(D)J designations.
These designations were checked by hand, possibly with the help of other bioinformatics tools.
Tests may range from very easy cases with unambiguous V(D)J designations
to borderline or difficult cases, including incomplete or unusual recombinations or translocations.
This collection of sequences helps the robustness of Vidjil (and potentially of other programs,
as this data is open-source). The automated test suite launches Vidjil on all these
sequences and compares the computed designations with the curated designations.
Tests where Vidjil currently fails will be marked as TODO.
Having a correct behavior on these tests may be a goal for future releases.
* Contributing to the tests
Users and developers are strongly encouraged to send us (=contact@vidjil.org=)
their manually curated sequences, ideally in the format described below, or by
directly proposing pull requests on GitHub with new tests in the [[https://github.com/vidjil/vidjil/tree/master/algo/tests/should-vdj-tests][=algo/tests/should-vdj=]] directory.
We can also help to encode sequences in this format.
* A =.should-vdj.fa= file
A =.should-vdj.fa= file is (almost) a Fasta file, containing one or several sequences
with their V(D)J designation:
#+BEGIN_EXAMPLE
>IGKV1-5*03 9/4/1 IGKJ1*01 [IGK]
TATTAATAACAACTTGGCCTGGTATCAGGAGAAGCCAGGGAAAGCCCCTAAGGTCCTG
ATCTATAAGGCGTCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGAT
CTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACCTA
TTACTGCCAACAATATAATAGACTTTGGACGTTCGGCCAAGGGACCAAGGTGGAAGTC
AAACGAACTGTGGCTGCACCATCT
# Patient 0122
>TRGV5*01 4/AG/5 TRGJP2*01 [TRG] # 1st clone
GGAAGGCCCCACAGCGTCTTCTGTACTATGACGTCTCCAACTCAAAGGATGTGTTGGAA
TCAGGACTCAGTCCAGGAAAGTATTATACTCATACACCCAGGAGGTGGAGCTGGATATT
GATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGA
ag
AGTGATTGGATCAAGACGTTTGCAAAAGGGACTAGGCTCATAGTAACTTCGCCTGGTAA
>TRGV11 TRGJ1 [TRG] # 2nd clone
TCTTCCACTTCCACTTtgAAAATAAAGTTCTTAGAGAAAGAAGATGAGGTGGTGTACC
aCTGTGCCTGCtaGTCACCTCATCGAATTATTATAAGA
#+END_EXAMPLE
Nucleotide sequences can mix upper-case and lower-case characters, and may contain arbitrary line breaks.
Comments can be given either as lines starting with =#=, or parts of headers, again starting with =#=.
* Encoding the V(D)J designation
The header of each sequence, beginning by =>=, gives the V(D)J designation of the underlying sequence,
such as in =>IGKV1-5*03 9/CTAC/1 IGKJ1*01 [IGK]=.
- Gene names are taken as specified in IMGT/GENE-DB.
They can be either fully qualified, with their alleles (=IGKJ1*01=) or without (=IGKJ1=).
When there is no allele given, the number of deletions for the N regions should refer to the =*01= allele.
Special names are also accepted, such as =Intron= or =KDE=.
- N-regions are given in three components: number of nucleotides deleted at the right (3') of the left segment,
insertion, and number of nucleotides deleted at the left (5') of the right segment.
The insertion can be specified either by the full sequence of nucleotides (=9/CCCTGG/1=),
or by only the number of nucleotides (=9/6/1=).
- N-regions are optional : =>IGKV1-5*03 IGKJ1*01= can be given instead of =>IGKV1-5*03 9/4/1 IGKJ1*01=
The designation can thus be very short, such as in =>TRGV2 TRGJP1=.
However, it is advised to put as much information as possible in the designation,
such as in =>TRGV2*01 9/CCCTGG/1 TRGJP1*01 [TRG]=.
Such complete designations will give more extensive tests.
VDJ recombinations can be encoded, such as
- =>IGHV3-74*02 7/CCGCGGT/6 IGHD3-9*01 4/CTTCGAACA/7 IGHJ4*02=
Incomplete or unusual recombinations can also be specified, such as
- =>IGHD7-27*01 10/CATTA/0 IGHJ3*02=
- =>TRDV1*01 TRDD2*01 TRAJ29*01=
- =>TRDD2 18/6/0 TRDD3 5/5/0 TRDJ1=
- =>Intron 2/0/9 KDE=
Very special cases should be explained by comments in plain English.
* Encoding the locus
The end of the header may also contain information on the locus, between brackets, leading to additional tests.
This also allows to specify only =>[TRG]= for a sequence that should be recognized as TRG
even if it is difficult to choose a precise VJ designation.
Human locus should be encoded by =[IGH]=, =[IGK]=, =[IGL]=, =[TRA]=, =[TRB]=, =[TRG]=, =[TRD]=.
Incomplete or unusual recombinations can be encoded with an additional =+= character, such as in =[IGH+]= or =[TRD+]=.
Mixed TRA/TRD recombinations can be encoded with =[TRA+D]=.
Other special cases, such as translocations involving BCL1 or BCL2, should be written now as comments after a =#= character.
* Ambiguous designations
On some sequences, several V(D)J designations may be equally acceptable.
A future format will allow to specify these alternatives.
It is advised now to leave a comment in plain English:
#+BEGIN_EXAMPLE
# or TRGJ1*01
>TRGV5*01 TRGJ1*02 [TRG]
...
#+END_EXAMPLE
* Running the tests
Vidjil can be tested on =.should-vdj= tests can be launched within the =algo/tests= directory:
- =python should-vdj-to-tap.py= runs one or several tests, given as parameters on the command line,
- =make shouldvdj= runs all =.should-vdj.fa= tests,
- =make shouldvdj_and_locus= further runs tests on the locus.
This locus test is also launched for all reverse complement sequences.
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment